calculate the average speed of a rambler who travels 12km in 3 hours​

Answers

Answer 1

Answer:

4km per hour

Explanation:

12/3=4

Hope this helps


Related Questions

Need help with translation and answers

Answers

Use the app called translate by goggle they let u take a picture and it gives you it.
I can help I’m good w Spanish

Forma oraciones impersonales con el pronombre se usando los siguentes verbos. escribe oraciones completas.
1. distribuir
2. emitir
3. presentar
4. traducir
5. otorgar

Answers

1. El oro se iba a distribuir mañana por la tarde.
2. Empezó a emitir un sonido, una especie de lamento.
3. Yo no sabía que pudiese presentar un aspecto tan antipático.
4.Karla tuvo que traducir al inglés su discurso para que así su maestra le diera puntos extras
5. Para el profesor era difícil elegir a quién podía otorgar el premio, sus alumnos eran muy buenos.

Espero esto te haya ayudado!
1. Ellos iban a distribuir la comida.

2. El amigo de aquella chica suele emitir en la radio.

3. A marcos le toca presentar el trabajo.

5. Juan Carlos no puede traducir eso.

6. Esta noche van a otorgar las medallas a los mejores estudiantes del año.

1.el rey de la selva
2.fenómeno natural por el que 3.la tierra se mueve
4.un ejemplo es la cobra
5.un sinónimo de pájaro
6.el ruido en una tormenta
7. un grupo de montañas

Answers


i only know number 2
it’s terremoto

¿de dónde venimos? ¿cómo pensaban y vivían nuestros bisabuelos y tatarabuelos?​

Answers

Answer:

de la vida, con una aspectativa differente ya que no tenian los avances tecnologycos que los que tenemos ahora

Explanation:

Cuando se usa conocer

A. Informacion
B. Persona, lugar o cosa

Answers

Answer:

b

Explanation:

Can someone do this?

Answers

Answer:

i have no clue what you are doing

Explanation:

B. Write sentences telling how the following people are feeling. Use the verb estar & the correct estar emotion.
1. Tú____________________________ _________________________________ (sad).
2. los maestros____________________________ _________________________________ (happy).
3. la chica ____________________________ _________________________________ (nervous).
4. Juan y yo ____________________________ _________________________________ (tired).
5. el estudiante ____________________________ _________________________________ (calm).

Answers

1) Tu estas triste? 2) Los maestros estan feliz. 3) La chica esta nerviosa. 4) Juan y yo estamos cansados. 5) el estudiante esta calmado

Mi es esposa de mi tío

Answers

Answer:

i dont understand you srry

My wife of my uncle?

(07.08 LC)
Mira la imagen, lee y escoge la opción con la expresión opuesta a la imagen. Look at
the images, read, and select the option with the opposite expression to the image. (1
point)
1) Estoy orgulloso.
2) Estoy contento.
3) Estoy enojado
4) Estoy enfermo

Answers

la respuesta es cuatro

La correcta sería que dos pasaran un día genial

3. Choose the correct verb to complete the sentence: José y yo
la tarea.
termino
terminamos
terminas

Answers

Answer:

terminamos

Explanation:

Answer:

the verb is terminanos

The Prado National Museum
Write the script for an audio tour in Spanish for a specific section or exhibition at the Prado Museum.

Answers

Answer:

please mark brainlist

Visual Guide to the Prado Museum

This Visual Guide is an educational resource intended to facilitate the preparation of the museum visit to people who understand better through images.

It has been compiled and illustrated with the participation of people with autism spectrum disorders, and it addresses different issues related to the museum: its history, its rules, its location, its buildings, its staff, the access points, and a series of formal and personal explanations of the museum artworks.

This autonomous material is intended to be a reference and support resource for educative environments and for relatives too.

—Me gusta mucho hablar de (1) familia. (2) abuelos son muy viejos. (3) padres son trabajadores y simpáticos. (4) hermana pequeña, Sara, es muy inteligente. Y, bueno, (5) hermano Raúl es tonto. Y tú, ¿cómo es (6) familia? —(7) escuela es muy grande. Yo vivo muy cerca de la escuela. (8) mejor (best) amiga se llama Filomena. A Filomena le gusta mucho estudiar química con (9) compañeros. Los sábados, ella visita a (10) abuelo

Answers

Answer:

Explanation:

Me gusta mucho hablar de (mi) familia. (mis) abuelos son muy viejos. (Mis) padres son trabajadores y simpáticos. (Mi) hermana pequeña, Sara, es muy inteligente. Y, bueno, (mi) hermano Raúl es tonto. Y tú, ¿cómo es (su) familia? —(Mi) escuela es muy grande. Yo vivo muy cerca de la escuela. (Mi) mejor (best) amiga se llama Filomena. A Filomena le gusta mucho estudiar química con (mis) compañeros. Los sábados, ella visita a (su) abuelo

1.Mi
2. Mis
3. Mis
4. Mi
5. Mi
6. Tu
7. Mi
8. Mi
9. Mis
10. Mi

Help

¡Vosotras nunca ___ ! (ponerse de acuerdo)

Mi primo Esteban y yo usualmente ___ inmediatamente después de una discusión. (reconciliarse)

Nosotras ___ las mochilas por accidente. (intercambiarse)

La pareja ___ con pequeños regalos todo el tiempo. (sorprenderse)

Chiqui y Marco ___ siempre que ___. (abrazarse) (verse)

¡Los novios ___ textos cada tres minutos, todo el día, todos los días! ¡Es demasiado! (escribirse)

Nosotros ___ siempre con mucho cariño. (besarse)

Los recién casados no ___ muy bien todavía. (conocerse)

Carli y yo ___ a menudo en el café de la esquina. (encontrarse)

Mi mamá y mi papá todavía ___ con amor. (mirarse)

¡Ellas ___ todo! (contarse)

Answers

Good luck I jus trees pts

Answer:

¡Vosotras nunca os ponéis de acuerdo !  

Mi primo Esteban y yo usualmente nos reconciliamos inmediatamente después de una discusión.  

Nosotras intercambiamos las mochilas por accidente.  

La pareja se sorprendió con pequeños regalos todo el tiempo.  

Chiqui y Marco se abrazan siempre que se ven.  

¡Los novios se escriben textos cada tres minutos, todo el día, todos los días! ¡Es demasiado!

Nosotros nos besamos siempre con mucho cariño.

Los recién casados no se conocen muy bien todavía.

Carli y yo nos encontramos a menudo en el café de la esquina.  

Mi mamá y mi papá todavía se miran con amor.  

¡Ellas se cuentan todo!

1. Según la grabación, ¿qué beneficios comerciales tienen las grasas parcialmente hidrogenadas ? (A) Dan mejor sabor a la comida . ( B) Hacen durar más la comida refrigerada . ( C) Poseen más valor nutritivo . ( D) Conservan los alimentos por más tiempo .

Answers

Explanation:

la respuesta es D ya que lo hace durar más tiempo y no este en descomposición

Now that you have worked through a lot of material that includes these basic patterns, and you have compared grammatically correct and incorrect sentences, write down what you think is a rule that could explain what makes a sentence grammatically correct or not. For example, you might write something like: "verbs always match nouns in number, and they usually come before the noun." In other words, make your best guess for the grammar rule that makes sense out of the pattern(s) you see in the phrases you have been working with. Review if you need to, and you might briefly check your hunches against the sentences you have been working with in this or previous modules. Keep in mind that what you're after is your hunch, not a grammar rule from a text book. Now check your hunch with the explanation of this principle in the following pattern.

Answers

Answer:

s, and you have compared grammatically correct and incorrect sentences, write down what you think is a rule that could explain what makes a sentence grammatically correct or not. For example, you might write something like: "verbs always match nouns in number, and they usually come before the noun." In other words, make your best guess foor the grammar rule that makes sense out of the pattern(s) you see in the phrases you have been working with. Review if you need to, and you might briefly check your hunches against the sentences you hav

Explanats, and you have compared grammatically correct and incorrect sentences, write down what you think is a rule that could explain what makes a sentence grammatically correct or not. For example, you might write something like: "verbs always match nouns in number, and they usually come before the noun." In other words, make your best guess for the grammar rule that makes sense out of the pattern(s) you see in the phrases you have been working with. Review if you need to, and you might briefly check your hunches against the sentences you havion:

s, and you have compared grammatically correct and incorrect sentences, write down what you think is a rule that could explain what makes a sentence grammatically correct or not. For example, you might write something like: "verbs always match nouns in number, and they usually come before the noun." In other words, make your best guess for the grammar rule that makes sense out of the pattern(s) you see in the phrases you have been working with. Review if you need to, and you might briefly check your hunches against the sentences you hav

I need help with thissss.Theres other questions that are also finishing the sentence with a verb

Answers

yo como, ellos beben, nosotros compartimos, tu -es (cannot read the word but the conjugate for -er verbs is -es)

i don’t understand this please help

Answers

1. No, a las nueve
2. No, traigo dulces
3. No, digo que es peor
4. No, vengo mañana
5. No, tengo una bicicleta
No a las nueva no trago dulces no Digo es pero no vengo mañana no tengo un bicicleta

que es el dolor de estómago en conocimiento científico?​

Answers

dolor de estómago puede enmarcarse en lo que los médicos llaman en términos científicos una 'epigastralgia'. Sus causas pueden ser tan variadas en origen y gravedad como un reflujo gastroesofágico, hasta una pancreatitis, o incluso una perforación intestinal.

Señor, ¿Ud. ____________________ el alemán? (hablar)

Answers

Answer:

Habla.

Explanation:

Habla...

Answer:
Habla

Have a great day!

veintitrés es agudas,llanas,esdrújulas o sobresdrujulas​

Answers

Answer:

Aguda

Explanation:

Vein-ti-trés

El acento esta en la ultima silaba

Miguel y Carmen _____ a las nueve y cuarto.

Answers

Answer:duermen?

Explanation:

Miguel y Carmen llegaron a las nueve y cuarto.

complete with correct form of tener

1. y tu, ¿____ hermanos?
2. ¿cuanto hermanos ______?
3. ¿_____ ustedes una mascota?
¿Que _____, un perro o un gato?
4. Nosotros ____ una casa privada.
5. La casa _____ cuarto dormitorios.
6. Yo _____ mi dormitorio y mis dos hermanos _____ su dormitorio.

Answers

Answer:

1. Tienes

2. Tienes

3. Tienen

4. Tienes

5. Tiene

6. Tengo, tienen

1: tienes
2: tienes
3: tienen
4: tienes
5: tienen
6: tengo y tienen

Please translate these English sentences to Spanish, keeping in mind imperfect tense and perfect tense. Thank you!!

As a child I used to read books.
When I was younger I ate a lot of snacks.
When I was younger I took a lot of naps.
When I was younger I used to climb trees.
When I was younger I played the violin.
When I was younger I annoyed my parents.
When I was younger I did ballet.
When I was younger I would paint a lot.
I used to skateboard when I was younger.
I would participate in school when I was younger.
I did gymnastics when I was younger.
When I was younger I played video games.
When I was younger I brushed my teeth 3 times a day.
When I was younger I was a lot of television.
When I was younger I did my homework.
When I was younger I was in girlscouts.
When I was younger I listened to music.
When I was younger I liked to star gaze.
When I was younger I enjoyed playing with makeup.
When I was younger I had a lot of chores.

Answers

Cuando era un niño, leía libros.

Cuando era joven...

comía muchos dulces

Tomaba muchas siestas.

Escalaba árboles.

Tocaba el violín

Avergonzaba a mis padres

brainliest plz

paco no le gustan estas pinturas porque el no el arte de los siglos pasados

Answers

Answer:

le gusta.            

Explanation:

A Paco no le gustan estas pinturas porque el no

le gusta

el arte de los siglos pasados.

PLEASE HELP WILL MARK BRAINLEST!
*only right answers*

mr sanchez a real estate agent is describing a house for rent to a possible tenant select the terms that most appropriately complete the paragraph.

Answers

Ahh sorry for this!!

Para formar el mandato formal, quita la -o. En el caso del verbo correr", ya que termina en -er, cambia el
verbo a la terminación opuesta. Es decir, la conjugación del mandato formal para correr es.
corro
corre
Corra
corres

Answers

Answer:

corra

Explanation:

Answer: Corra

Explanation: because tacos

What does the underlined word mean in the following sentence?
Anoche fuimos al aeropuerto.
O airport
o church
0 hair salon
O post office​

Answers

Answer:

A) Airport

Explanation:

The answer will be airport

Help

¡Vosotras nunca ___ ! (ponerse de acuerdo)

Mi primo Esteban y yo usualmente ___ inmediatamente después de una discusión. (reconciliarse)

Nosotras ___ las mochilas por accidente. (intercambiarse)

La pareja ___ con pequeños regalos todo el tiempo. (sorprenderse)

Chiqui y Marco ___ siempre que ___. (abrazarse) (verse)

¡Los novios ___ textos cada tres minutos, todo el día, todos los días! ¡Es demasiado! (escribirse)

Nosotros ___ siempre con mucho cariño. (besarse)

Los recién casados no ___ muy bien todavía. (conocerse)

Carli y yo ___ a menudo en el café de la esquina. (encontrarse)

Mi mamá y mi papá todavía ___ con amor. (mirarse)

¡Ellas ___ todo! (contarse)

Answers

Answer:

¡Vosotras nunca os ponéis de acuerdo!

Mi primo Esteban y yo usualmente nos reconciliamos inmediatamente después de una discusión.  

Nosotras intercambiamos las mochilas por accidente.  

La pareja se sorprendió con pequeños regalos todo el tiempo.  

Chiqui y Marco se abrazan siempre que se ven.  

¡Los novios se escriben textos cada tres minutos, todo el día, todos los días! ¡Es demasiado!

Nosotros nos besamos siempre con mucho cariño.

Los recién casados no se conocen muy bien todavía.

Carli y yo nos encontramos a menudo en el café de la esquina.  

Mi mamá y mi papá todavía se miran con amor.  

¡Ellas se cuentan todo!

Explanation:

Cuales son mandatos regulares?

Answers

Answer:

Un mandato es un mandato oficial o un visto bueno. Cuando un político gana una elección por un amplio margen, es un mandato para implementar sus ideas. Un mandato da autoridad. ... Un político que cree en impuestos más altos y luego es electo considera que es un mandato subir los impuestos.

Explanation:

Read and choose the correct verb to complete the sentence.

Ayer, yo ________ que iba a ir a Venezuela. (1 point)
pude
supe
tuve
quise

Answers

Ayer, yo supe que iba a ir a Venezuela.

Answer:

supe

Explanation:

Ayer, yo supe que iba a ir a Venezuela it sounds good when you read it like that

Other Questions
A slide at a children's park is 74 inches tall in the horizontal distance The slide covers is 70 inches what is the angle measures created by the slide and the ground a cyclist covers a distance of 15km in 2hours calculate his speed Who suspects Macbeth of foul play? 6.The bolded words are " I long to hear you", and " I long to hear you".Read the following passage from Shenandoah. Which sound device is expressed by the bolded words?Shenandoah, I long to hear you,Away, you rolling river,Oh, Shenandoah, I long to hear you,Away, I'm bound away,'Cross the wide Missouri.A. refrainB. repetitionC. alliterationD. rhyme Civil rights in the United States are meant to make sure that: A. all races are treated equally. B. states can segregate services. C. the courts don't have too much power. D. schools get enough money to operate.I will give brainliest. Question 1 ( point) A 64g sample of Germanium-66 is left undisturbed for 12.5 hours. At the end of that period, only 2.0g remain. How many half-lives transpired during this time period? half-lives Answer = Blank 1: The sum of a number and six times its reciprocal is 10. Find the number If this work is a throne for the greatest rapper, who should occupy it? Make a case. What is the meaning of the term metabolism? The term "para" in Paralympics means? Use the points in each diagram to name the figure shown what is - 5 = -2 what is the questionwhat is the question Solve for x. Enter the solutions from least to greatest. (5x+4)(x3)=0lesser x= greater x= what's the fourth proportional of 0.2, 0.5, 6 transcribe this strand of DNA 5' 3 TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid- What is the best name for polynomial with 3 terms that has a degree PLEASE HELP ITS DONE IN 16 HOURSSS!!!question: A substance with 12 negatively charged atoms combined with a substance that has 10 positively charge atoms. What is the total charge of the substance when the atoms are combined?answer options: +22-22+2-2 6. What were the first Native American civilizations, and where were they located? Estoy tan aburrida as que aqu hay algunos puntos gratis. What percentage of Americans use solar power ?