Answer: The genetic material of the cell is duplicated during S phase of interphase just as it was with mitosis resulting in 46 chromosomes and 92 chromatids during Prophase I and Metaphase I. However, these chromosomes are not arranged in the same way as they were during mitosis.
Explanation:
scientific and common name for this?
Answer:
The common name for this is Moss
Scientific name is Bryophyta
Explanation:
Multiple Choice
A student observed bees flying between flowers on a squash vine. after researching this activity, the student learns that bees obtain nectar from the flowers. The pollen from the flowers sticks to the bees and is transported to another flower of the same species, resulting in pollination. The student decides this is an example of mutualism. Which table explains why this relationship is mutualism?
Answer:
The answer is D
Explanation:
Flowers and bees both benefit from pollination so D
Answer: that should be d
Explanation:
the chief purpose of the photosynthetic process is considered to be the
Why do we not use a Punnett Square to determine the offspring for asexual reproduction? Is that form of reproduction diverse? Explain your answer.
Answer: There isn’t another organism to cross with
Explanation:
In asexual reproduction there is only one parent so all the genes come from one person.
The Moon completes one orbit around the Earth in approximately
in approximately
and completes one cycle of its phases
A 271/3 days, 24 hours
B 24 hours, 24 hours
C 24 hours, 29 1/2 days
D 27 1/3 days, 29 1/2 days
Answer:
Answer is D
Explanation:
Takes about then to circle the Earth
Answer:
It takes 27 days, 7 hours, and 43 minutes
Explanation:
A child has a mass of 30 Kg on earth. If the gravity on the Moon is one sixth that of the earth what is the mass of the child moon
Answer:
30 kilograms
Explanation:
A change in gravity does not affect mass.
What is the meaning of the term metabolism?
During cellular respiration, energy is transferred from *
1 point
A. ATP to glucose
B. CO2 to enzymes
c. sunlight to glucose
D. glucose to ATP
Answer:
a or b I'm sorry but I know it's not c
Answer:
A? im not sure..................
Which of the following is an advantage of meiosis and sexual reproduction?
A. Meiosis ensures that offspring will not inherit any genetic disorders.
B. Meiosis ensures that offspring are genetically identical as their parents.
C. Meiosis ensures that offspring will have identical phenotypes to their parents.
D. Meiosis ensures a wider variety of genetic variation.
Answer:
D. Meiosis ensures a wider variety of genetic variation.
This happens above all thanks to the Crossing over, the process in which the exchange of genetic material during sexual reproduction between two homologous chromosomes' non-sister chromatids results in recombinant chromosomes.
Why do we want to produce genetically different organisms?
Answer: Genetically engineered crops produce higher yields, have a longer shelf life, are resistant to diseases and pests, and even taste better.
Explanation:
A plant produces seed cones and pollen cones . Is it vascular? To what group of plants does it belong
A plant that produces seed cones and pollen cones is a vascular plant, and plants that produce seed cones and pollen cones belong to the group of plants known as gymnosperms.
What are gymnosperms?Gymnosperms are a group of seed plants that produce seeds that are not enclosed in an ovary and produce open seeds that are usually borne in cones and include a variety of plant species, including conifers such as pine, spruce, and fir trees, cycads such as palm-like plants, ginkgoes, etc., and the production of seed cones and pollen cones is a vital characteristic of gymnosperms, these seed cones, which are also called female cones, produce seeds that are typically larger and more complex than pollen grains.
Hence, a plant that produces seed cones and pollen cones is a vascular plant and belongs to the group of plants known as gymnosperms.
Find out more about gymnosperms here.
https://brainly.com/question/15158870
#SPJ2
Archie Carr helped save turtles from extinction. What did he do during Operation Green Turtle?
A.) He made laws against hunting turtles.
B.) He took turtle eggs to safe beaches.
C.) He cleaned the turtles after an oil spill.
D.) He planted grasses that turtles eat.
Answer:B
Explanation:The project distributed green turtle eggs and hatchlings to various nesting beaches around the Caribbean and the Gulf of Mexico in an effort to encourage the growth of their dwindling populations. His conservation efforts also led him to lead campaigns against ocean pollution.
How does natural selection lead to the evolution of a species?
Answer:
One of these is natural selection, which is a process that increases the frequency of advantageous gene variants, called alleles, in a population. Natural selection can result in organisms that are more likely to survive and reproduce and may eventually lead to speciation.
Explanation:
What happens to chromosomes when an ovum and a sperm meet at fertilisation
Answer: When egg and sperm cells combine in fertilizations, they merge the two sets of chromosomes, ending up with 46 chromosomes in total. The maternal chromosomes from the egg cell and the paternal chromosomes from the sperm cell pair up. The resultant cell is called a zygote. Fertilization happens when a sperm cell successfully meets an egg cell in the fallopian tube. Once fertilization takes place, this newly fertilized cell is called a zygote. From here, the zygote will move down the fallopian tube and into the uterus. The zygote then burrows into the uterus lining.
Explanation:
What percentage of Americans use solar power ?
Answer:
66.7 percent.
Explanation:
2. Write the complementary DNA strand: (1 points)
CTT GAC TGA TGC
Which of the following is true about the role of genetic and environmental factors in human health?
A) Genes are the only factor affecting whether or not an idividual will contract a disease.
B) Genetic factors are more important than environmental factors in determining an individual's
personal health risks.
C) Individuals can influence their health by controlling their genetic traits.
D) Environmental factors determine whether or not all genetic traits lead to health issues.
E) Certain environments can lead to an increased risk of developing certain diseases.
Answer:
E) Certain environments can lead to an increased risk of developing certain diseases.
Explanation:
The lesson states that specific environments can increase the chance of health problems.
Are enzymes needed for metabolism?
A. YES!
B. NO!
C. MAYBE SO!
D. ALL OF THE ABOVE (This option clearly makes no sense! Don't pick it!)
Answer:
YES! (Don't mean to yell, but those were the options.)
Explanation:
Enzymes break down food, and therefore, are needed for metabolism.
Why do we care how strong a rock is?
Answer:
hahahahahahahaha
Explanation:
because
Answer:
to throw it at ur cheating bf
Explanation:
lma.o
° • .°• ✯
★ * ° °·
. • ° ★ • ☄
▁▂▃▄▅▆▇▇▆▅▄▃▁▂
what happens to most solar radiation when it gets to earth??
Answer:
Most of the solar radiation is bounced off of earth´s atmosphere.
Explanation:
Due to earth´s magnetic field, we are able to be protected from most of the solar radiation the sun emits.
Which function of the integumentary system is illustrated in the release of sweat?
Absorbtion
Protection
Sensory Reception
Regulation
Secretion
Both regulation and secretion
Answer:
Secretion
Explanation:
Not completely sure tho, good luck
White blood cells ingest, then digest, a number of bacteria and other pathogens. White blood cells would require high numbers of which organelle in order to function properly?
Answer:
Lysosome
Explanation:
A student examines a periodic table.
Which inferences about sodium (Na) are true?
Answer:
true c this is the answer
why is this conversion of energy from one molecule to another necessary for all cells?
[tex]\mathfrak{\huge{\orange{\underline{\underline{AnSwEr:-}}}}}[/tex]
Actually Welcome to the Concept of the energy conversion
=> ATP can be used to store energy for future reactions or be withdrawn to pay for reactions when energy is required by the cell.
=> When one phosphate group is removed by breaking a phosphoanhydride bond in a process called hydrolysis, energy is released, and ATP is converted to adenosine diphosphate (ADP).
What are the two most common sources for rivers and streams?
Answer:The source of a river or stream may be a lake, a marsh, a spring, glacier, or a collection of headwaters. The furthest stream is called the headstream. Headwaters are small streams that create the river or stream and may be cool waters, because of shade and barely melted ice or rain.
Explanation:I did this in class 2 days ago LOL
Answer:
The source of a river or stream may be a lake, a marsh, a spring, glacier, or a collection of headwaters. The furthest stream is called the headstream. Headwaters are small streams that create the river or stream and may be cool waters, because of shade and barely melted ice or rain.
Explanation:
Hope this helped you :D
list the planets from smallest to largest
Answer:
Mercury, Mars, Venus, Earth, Neptune, Uranus, Saturn, and Jupiter
Explanation:
Answer:
Mercury, Mars, Venus, Earth, Neptune, Uranus, Saturn, and Jupiter.
Explanation:
hope this helps!!!:)
SCIENCE ASSAP PLS
what does secondary succession mean in science
transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-
Answer:
AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG
Explanation:
this is the complementary strand for the mRNA.
A=U
C=G
G=C
T=A
this is the key for any mRNA strand.
;)
Type a paragraph describing how the circulatory and respiratory systems work together to deliver oxygen to the body’s tissues and remove carbon dioxide.
i. Include the names of structures and other components that play a role in gas
exchange.
ii. Explain how the interactions between the circulatory and respiratory systems
contribute to maintaining homeostasis in the body.
b) Type a second paragraph comparing the accuracy of your model to actual organ systems and
their functions.
i. Consider how a model is different from an actual human body.
ii. Describe the limitations of a model
Answer:
The circulatory and respiratory systems work together to circulate blood and oxygen throughout the body. Air moves in and out of the lungs through the trachea, bronchi, and bronchioles. Blood moves in and out of the lungs through the pulmonary arteries and veins that connect to the heart.
The circulatory and respiratory system work together to provide oxygen and remove carbondioxide gas.
How circulatory and respiratory system work together?The circulatory and respiratory systems work together to circulate blood and oxygen throughout the body. Air moves in to bring oxygen and out of the lungs to remove carbondioxde gas from the body. Blood moves into the lungs to bring carbondioxide gas and to load oxygen with the help of pumping of heart.
So we can conclude that circulatory and respiratory system work together to provide oxygen and remove carbondioxide gas.
Learn more about system here: https://brainly.com/question/14323743
One Multiple Choice (A, B, or C) question and one True/False question.
For probability and permutations and combinations