Probability is a measure of how likely an event is to occur. Choose the probability that best matches each of the following statements: (a) This event is impossible: [ Select ] (b) This event will occur more often than not, but is not extremely likely: [ Select ] (c) This event is extremely unlikely, but it will occur once in a while in a long sequence of trials: [ Select ] (d) This event will occur for sure: [ Select ]

Answers

Answer 1

Answer:

(a) 0

(b) 0.6

(c) 0.01

(d) 1

Step-by-step explanation:

Given

Probabilities: 0, 0.01, 0.3, 0.6, 0.99, and 1 ---> Missing information

Required

Match the probabilities with appropriate values

(a) Impossible:

An impossible event will always have a probability of 0

(b) Occurrence is more often than not, but not extremely likely:

An event that will occur more often than not will have a probability greater than 0.5 but less than 1

However, if the likelihood is not extremely likely, the probability will be closer to 0.5 and 1.

The probability that matches this description is 0.6

(c) Occurrence is extremely unlikely, but will occur once in a while

An event that is extremely unlikely will have a value greater than 0 and the value will be very close to 0.

The probability that matches this description is 0.01

(d) A certain event:

A certain event has a probability of 1


Related Questions

Find the product of 2.1n(6n + 3.4).

12.6n + 3.4
8.1n + 3.4
8.1n2 + 7.14n
12.6n2 + 7.14n

Answers

12.6n2+7.14n is the right option have a good day :)
I think the last one is right. 12.6n2+7.14n

the probability that an international flight leaving is delay in departing (event D) is .28. The probability that an international flight is a transpacific flight is (event P) is .55. The probability that an international flight leaving the U.S is a transpacific flight and delay is .13. What is the probability that an international flight leaving the United states is delay in departing given that the flight is a transpacific flight?

Answers

The probability that an international flight leaving the United states is delay in departing given that the flight is a transpacific flight is 0.7

What is probability?

Probability describes the likelihood of an event happening. In real life, we frequently have to make predictions about how things will turn out. We may be aware of the result of an occurrence or not.

The chance of an event can be calculated using the probability formula by simply dividing the favorable number of possibilities by the total number of outcomes. The probability of an event occurring can be anything between 0 and 1, as the favorable number of outcomes can never exceed the total number of outcomes.

According to the question,

P(D)=0.28

P(P)=0.55

P(D∩P)=0.13

Thus, the required probability,

P(DUP)=P(D)+P(P)-P(D∩P)

            =0.28+0.55-0.13

            =0.70

Learn more about probability here:

https://brainly.com/question/24756209

#SPJ1

Determine the equation (picture).

Answers

The line perpendicular to the equation and has the same y-intercept with another is y = - 4 / 3 x + 4.

How to find equation of a line?

The equation of a line can be describe as follows:

y = mx + b

where

m = slopeb = y-intercept

Therefore, lines that a perpendicular follows the rule below:

m₁m₂ = -1

Hence,

y + 6 = 3 / 4 (x - 2)

y + 6 = 3 / 4 x - 6 / 4

y =  3 / 4 x - 6 / 4 - 6

y = 3 / 4 x - 30 / 4

y = 3 / 4 x - 15 / 2

Hence,

3 / 4 m₂ = -1

m₂ = - 4 / 3

Therefore,

slope of the line is - 4 / 3

Let's find the y-intercept of the second line

4x + 5y -20 = 0

5y = -4x + 20

y = -4 / 5 x + 4

y-intercept  = 4

Therefore, the line perpendicular to the equation and has the same y-intercept with another is y = - 4 / 3 x + 4.

learn more on equation here: https://brainly.com/question/14005330

#SPJ1

IM IN A HURRY PLEASE HELP ME QUESTION IS DOWN BELOW WORTH 15 POINTS each

Answers

Answer: A = JIH

B = GJH

C = GH

D = 300

E = 60

Step-by-step explanation:

A) <JIH is a inscribed angle

B) GJH is a major arc

C) GH is a minor arc

D) m GH = m<GFh = 60

Find the measure of x

Answers

Answer:

113°

Step-by-step explanation:

Angles that form a linear pair are supplementary, and thus add to 180°.

Sets J and F are defined as follows.
J= {c,e,f}
F={g,k,j}
Answer each part below. Write your answer in roster form or as 0.
Find the intersection of J and F.
FInd the union of J and F.

Answers

The value of J ∩ F =  ∅

The value of J ∪ F = {c, e, f, g, k, j}

What is an expression?

Mathematical expression is defined as the collection of the numbers variables and functions by using operations like addition, subtraction, multiplication, and division.

Given that;

Sets J and F are defined as follows;

J = {c, e, f}

F = {g, k, j}

Now,

Since, Sets J and F are defined as follows;

J = {c, e, f}

F = {g, k, j}

Hence, The value of J ∩ F =  {c, e, f} ∩ {g, k, j}

                                         = ∅

The value of J ∪ F = {c, e, f} ∪ {g, k, j}

                            = {c, e, f, g, k, j}

Thus, The value of J ∩ F =  ∅

The value of J ∪ F = {c, e, f, g, k, j}

Learn more about the mathematical expression visit:

brainly.com/question/1859113

#SPJ1

Which algebraic expression is equivalent to the expression below 5(5x + 7) - 6 (4- 2x)

Answers

The algebraic expression equivalent to the expression 5(5x + 7) - 6 (4- 2x) is 37x + 11.

What is the equivalent of the expression?

Given the expression; 5(5x + 7) - 6 (4- 2x)

We expand and collect like terms.

5(5x + 7) - 6 (4- 2x)

25x + 35 -24 + 12x

We collect like terms

25x + 12x + 35 - 24

37x + 11

Therefore, the algebraic expression equivalent to the expression 5(5x + 7) - 6 (4- 2x) is 37x + 11.

Learn more about algebraic expression here: brainly.com/question/13947055

#SPJ1

please open the attached image

Answers

The function that will have a horizontal asymptotes are function B, C and D

Horizontal asymptotes of a function

A function is said to have a horizontal asymptotes of the degree of the numerator is less or equal to that of the denominator.

From the rational expression given, the function A and E wil have no horizontal asymptotes since the power of the numerator is greater abd equal to the denominator,

The function that will have a horizontal asymptotes are function B, C and D

Learn more on horizontal asymptotes here: https://brainly.com/question/4138300

#SPJ1

Can someone help me with this plss

Answers

Answer:

6. Quadrant four

7. Quadrant three

8. Quadrant one

Step-by-step explanation:

These questions give you points to graph and then asks which quadrants they are graphed in. Here is a visual.

A carpenter built a square table with side length x. Next, he will build a rectangular table by tripling one side and halving the other. The area of the rectangular table is represented by the expression (3 x)(one-half x).

A square with sides x. A rectangle with side one-half x and side 3 x.

What is the simplified expression for the area of the rectangular table?

Three-halves x squared
Three-halves x
Five-halves x squared
Five-halves x

Answers

The area of a rectangle is given by its length multiplied by its width. So that the expression that represents the area of the rectangle in the given question is  [tex]\frac{3}{2}[/tex] [tex]x^{2}[/tex] squared unit.

A rectangle is a figure that has four straight sides, in which opposite sides are equal.

The area of a rectangle can be determined by the expression;

Area = length x width

Thus considering the given question, the length of the rectangle is tribble to that of the square. And the width of the rectangle is half of that of the square.

So that;

length = 3x

width = [tex]\frac{x}{2}[/tex]

Thus,

Area = length x width

        = 3x ([tex]\frac{x}{2}[/tex])

        = [tex]\frac{3}{2}[/tex] [tex]x^{2}[/tex]

Therefore, the area of the rectangle is  [tex]\frac{3}{2}[/tex] [tex]x^{2}[/tex] squared unit.

For more clarifications on the area of a rectangle, visit: https://brainly.com/question/25292087

#SPJ1

what is the equation for -2(5x+8)

Answers

Answer:

Step-by-step explanation:

-10x-16

Answer:

distribute the -2 so your answer is -10x-16

Step-by-step explanation:

Which statement most clearly shows an example of ethos? There is nothing more important than making sure everyone has access to a quality education. O Today, too many recent college graduates are struggling to secure a job in their field of study. O As the CEO of a major technology company, I am constantly making tough hiring decisions. O While a college education isn't everything, it does make a difference on a job application. Mark this and return Save and Exit Next Submit​

Answers

The statement that most clearly shows an example of ethos is C. As the CEO of a major technology company, I am constantly making tough hiring decisions.

What is an ethos statement?

An ethos statement establishes the credibility, knowledge, and good moral character of the speaker or writer.

The use of ethos is meant to sound fair or to demonstrate credibility, expertise, education, or pedigree.

Thus, an example of ethos is when this CEO claims they constantly make tough hiring decisions.

Learn more about ethos at https://brainly.com/question/13118125

#SPJ1

Choose the equation that matches
the graph.

a.y = 3x - 2
b. y = 3x-2
c. y = 3x+2
d. y = 3x + 2
e. y = (1/3)x-2

Answers

Answer:

it matches with equation a

Which of the following expressions does sin(x + y) - sin(x - y) simplify to?
O2(sin x)(sin y)
O2(sin x)(cos y)
O2(cos x)(cos y)
O 2(cos x) (sin y)

Answers

The answer choice which sin(x + y) - sin(x - y) simplifies to is; 2(cos x)(sin y).

Which of the following expressions does sin(x + y) - sin(x - y) simplify to?

It follows from the task content that the expression given in the task content can be simplified by trigonometric identities as follows;

sin(x + y) - sin(x - y) = sinxcosy + cosxsiny - (sinxcosy -cosxsiny)

= 2cosxsiny.

Read more on trigonometric identities;

https://brainly.com/question/7331447

#SPJ1

At some department​ store, all suits are reduced ​20% from the retail price. If a man purchased a suit that originally retailed for 231​.20 how much did he​ save?

Answers

well, we know the suits are all reduced by 20%, so the man saved 20% of 231.20

[tex]\begin{array}{|c|ll} \cline{1-1} \textit{a\% of b}\\ \cline{1-1} \\ \left( \cfrac{a}{100} \right)\cdot b \\\\ \cline{1-1} \end{array}~\hspace{5em}\stackrel{\textit{20\% of 231.20}}{\left( \cfrac{20}{100} \right)231.20}\implies 46.24[/tex]

8.
Find the arc length of a central angle of 7pi/3 in a circle whose radius is
3inches

Answers

[tex]\textit{arc's length}\\\\ s = r\theta ~~ \begin{cases} r=radius\\ \theta =\stackrel{radians}{angle}\\[-0.5em] \hrulefill\\ \theta =\frac{7\pi }{3}\\ r=3 \end{cases}\implies s=(3)(\frac{7\pi }{3})\implies s=7\pi \implies s\approx 21.99~in[/tex]

ASAP PLEASE

Which point us the coordinate of the image of A under the transformation [0 1 1 0]

(-2,4)
(2,4)
(4,2)
(-4,-2)

Answers

Answer:

Step-by-step explanation:

(4, 2)

will you brainlyest?

Kite A B C D is shown. Lines are drawn from point A to point C and from point B to point D and intersect.
Figure ABCD is a kite. The area of ABCD is 48 square units. The length of line segment BD is 8 units.

What is the length of AC?

5 units
6 units
10 units
12 units

Answers

The length of AC is 12 units . Option D

How to determine the length

The formula for area of a kite is given thus;

Area = [tex]\frac{p * q}{2}[/tex]

Where p and q are the lengths

Area of kite = 48 square units

BD, q = 8 units

AC , p = unknown

Substitute the values

[tex]48 = \frac{AC * 8}{2}[/tex]

Cross multiply

[tex]AC * 8 = 48 * 2[/tex]

[tex]8AC = 96[/tex]

[tex]AC = \frac{96}{8}[/tex]

[tex]AC = 12[/tex] units

Thus, the length of AC is 12 units . Option D

Learn more about area of a kite here:

https://brainly.in/question/33613094

#SPJ1

Answer:option 4

Step-by-step explanation:

Practice 3
Solving a Special Solution inequality
17<3h+2<2
h>______
h <______

Answers

Answer:

  h > 5

  h < 0

Step-by-step explanation:

We suppose that a "Special Solution" inequality is one that is technically incorrect, but is written using a compact "shorthand" form.

As written, the inequality claims that 17 < 2, which is false. There can be no value of the variable that will make this true. We presume the intended meaning is ...

  17 < 3h +2   or   3h +2 < 2

Special solution

Subtracting 2 from the inequality gives ...

  15 < 3h < 0

Dividing by 3 gives ...

  5 < h < 0

There is no value of h that is both greater than 5 and less than 0, so we presume this means the OR (union) of the solution sets ...

  h > 5

  h < 0

average person burns approximately 221 calories per half-hour while bicycling. If a person does 2 hours of bicycling per day then how many calories will they burn in a week if they work out 5 days a week?

Answers

Answer: 4420 cals

Explaining:
221 every half hour
To find every hour you times it by 2 which equals to 442
1 hour = 442
2 hours = 442 times 2
2 hours= 884
To find how much a week you times it by 5
884 times 5
Equals to 4420 cals a week

Which equation is represented by the graph below?


A. Y= 1/8e^x
B. Y= 1/2e^x
c. Y=2e^x
D. Y= 8e^x

#49

Answers

Answer:

B

Step-by-step explanation:

When x = 1, it appears y is in between 1 and 2.

The only choice that satisfies this is B.

Answer:

The equation that represents the graph is y=2e^x

Step-by-step explanation:

plug in geogebra and confirm:D

The nurse must give a patient 9 milligrams of a medication. If the tables are 2 milligrams each, how many tablets are needed?

Answers

Answer:

4.5 tablets.

Step-by-step explanation:

We just divide 9 by 2.

13. The tablets needed is 4 and a half.

14. There are 10 half-gram doses available from the 5 gram vials of medication.

15. Pat's heart beats approximately 58.5 times in 3/4 of a minute.

Given are words problems based on the mixed numbers:

13. To determine the number of tablets needed, we divide the total dosage required by the dosage per tablet.

In this case, the nurse needs to administer 9 milligrams of medication, and each tablet contains 2 milligrams.

So, the number of tablets needed is:

9 milligrams / 2 milligrams per tablet = 4.5 tablets

Hence, the tablets needed is 4 and a half.

14. If the pharmacy has 5 gram vials of medication, we can calculate the number of 1/2 gram doses available by dividing the total amount of medication by the dose size.

The total amount of medication in grams is 5 grams.

To find the number of 1/2 gram doses available, we divide the total amount of medication (5 grams) by the dose size (1/2 gram):

5 grams / (1/2 gram) = 5 grams x (2/1 gram)

= 5 x 2 = 10 doses.

Therefore, there are 10 half-gram doses available from the 5 gram vials of medication.

15. To calculate how many times Pat's heart beats in 3/4 of a minute, you can use a simple proportion:

1 minute = 78 beats

3/4 minute = ? beats

Let's solve for the number of beats in 3/4 of a minute:

Number of beats in 3/4 minute = (3/4) x 78

= 0.75 x 78

= 58.5

So, Pat's heart beats approximately 58.5 times in 3/4 of a minute. Since you can't have half a heartbeat, the closest whole number is 58 beats.

Learn more about Mixed Numbers click;

https://brainly.com/question/24137171

#SPJ4

Which of the following equation(s) has/have slope zero?
a. x = 2
b.y = -3
c. y = 5x+2
d. x+ 5 = 0
O Both a and c
Only c
O Only b
O Both a and d

Answers

Answer:

b, only b

y = -3 has zero slope.

Step-by-step explanation:

Only a horizontal line has zero slope. A horizontal line's equation is given in the form: "y equals a number" So y=-3 is horizontal with zero slope.

Vertical lines have undefined slope. This is not the same as zero. Vertical lines have an equation in the form x= anumber. Above in the answer choices, choice a and d are both vertical with undefined slope and are not the correct answer. Choice c has slope 5, because that is the number beside the x in the form y=mx+b where m is the slope. So choice c is also not the answer.

Only choice b has zero slope.

Find the vertex, focus and diretrix of x^2+4x-12y=-64
It needs to be in (x-h)^2=4p(y-k) form

Answers

Vertex of the equation is (-2, 5)

Focus of the equation is (-2, 8)

Directrix of the equation is 2

What is a Quadratic curve?

A quadratic curve is a parabolic curve is a graph of the points which define a quadratic function. It shows how a function behaves in the cartesian plane.

Quadratic curve may bend upwards, or downwards depending on the gradient of the curve.

Analysis:

setting the equation in the form, [tex]x^{2}[/tex] +4x -12y = -64 in the form [tex](x-h)^{2}[/tex] = 4p(y-k)

Firstly we take -12y to the right hand side

[tex]x^{2}[/tex] +4x = 12y - 64

Making the left hand side a perfect square expression, we square both sides with -2

[tex]x^{2}[/tex] +4x + [tex](2)^{2}[/tex] = 12y -64 + [tex](2)^{2}[/tex]

[tex](x+2)^{2}[/tex] = 12y -60

[tex](x+2)^{2}[/tex]  = 12(y - 5)

comparing with the other equation

-h = , h = -2, -k = - 5 k = 5, 4p = 12, p = 3

Vertex is (h, k) = (-2, 5)

Focus is (h, k+p) = (-2, 5+3) = (-2, 8)

Directrix is y = k-p = 5 - 3 = 2

Learn more about Quadratic curves: brainly.com/question/1214333

#SPJ1

Claire has 18 nail polish bottles while Becky has 2/3 of that amount. How many bottles of nail polish does Becky have?​

Answers

Answer:

15/16

Step-by-step explanation:

because 2/3have Becky

A dairy farmer wants to mix 75% protein supplement and 50% protein ration to make 1400 pounds of a high grade 70% protein ration. How many pounds of each should he use

Answers

The dairy farmer would mix 1120 pounds of 75% protein supplement and 280 pounds of 50% protein ration to make 1400 pounds of a high grade 70% protein ration.

What is an equation?

An equation is an expression that shows the relationship between two or more variables and numbers.

Let x represent the amount of 75% protein supplement and y represent the amount of 50% protein, hence:

x + y = 1400     (1)

Also:

0.75x + 0.5y = 0.7(1400)     (2)

Hence:

x = 1120, y = 280

The dairy farmer would mix 1120 pounds of 75% protein supplement and 280 pounds of 50% protein ration to make 1400 pounds of a high grade 70% protein ration.

Find out more on equation at: https://brainly.com/question/2972832

#SPJ1

bryan brought 8/10 gallon of water on a hiking trip.he drank 4/10 gallon of water.how much water is left

Answers

The amount of water left is 4/10 gallons

Difference of fractions

Fractions are written as a ratio of two integers

Given the following parameters

Amount of gallon bought = 8/10 gallons

Amount he drank = 4/10

Determine the amount left

Amount left = 8/10 -4/10

Amount left = 4/10 gallons

Hence the amount of water left is 4/10 gallons

Learn more on difference of fraction here: https://brainly.com/question/20323470

#SPJ1

f is a trigonometric function of the form f(x)=asin(bx+c)+d. The function intersects its midline at (π,−4) and has a minimum point at ( π/4 , − 5.5 ). Find a formula for f(x). Give an exact expression.

Answers

The given point on the midline of (π, -4), and the minimum point of (π/4, -5.5), give the exact expression for f(x) as; f(x) = 1.5•sin((2/3)•(x - π)) - 4.

Which method can be used to find the trigonometric function?

The amplitude, a = The difference between the y-values at the minimum point and the midline

Therefore;

a = -4 - (-5.5) = 1.5

d = The difference between the y-values of the midline and the x-axis

Therefore;

d = -4 - 0 = -4

The given function is presented as follows;

f(x) = a•sin(b•x + c) + d

Which gives;

-4 = 1.5•sin(b•π + c) - 4

sin(b•π + c) = 0

(b•π + c) = 0

-c/b = π

c = -b•π

Therefore;

-5.5 = 1.5•sin(b•π/4 + c) - 4

-1.5 = 1.5•sin(b•π/4 + c)

-1 = sin(b•π/4 - b•π) = sin(-3•b•π/4)

-3•b•π/4 = arcsine (-1) = -π/2

-3•b•π/4 = -π/2

3•b/4 = 1/2

b = 2/3

c = -(2/3)•π

Therefore, f(x) = a•sin(b•x + c) + d, gives;

f(x) = 1.5•sin((2/3)•x - (2/3)•π) - 4

By simplification, the exact expression for f(x) is therefore;

f(x) = 1.5•sin((2/3)•(x - π)) - 4

Learn more about the the general form of the sine function here:

https://brainly.com/question/12102275

#SPJ1

D. 12:28
es 22. The label on a box of cereal states that it
contains 6 servings. If there are 7.5 cups in
the box, how many cups of cereal are there
per serving?

Answers

1.25 cups per serving

CAB SOMEONE HELP ME ASAP PLS

Answers

A,
The shaded area for yellow is less than 1/5 of a circle, so the answer is the first one.
Other Questions
FILL IN THE BLANK. A system that supplies a ____ and is derived from a transformer rated no more than 1000 volt amperes does not require a grounding electrode conductor If the age of the Earth is 4.6 billion years, what should be the ratio of Opb in a uranium-bearing rock as old as the Earth? 238U 206Pb 238U = 0.9997 x determine the degree of the maclaurin polynomial of 10 sin (x) necessary to guarantee the error in the estimate of 10 sin (0.13) is less than 0.001. to test whether a change in price will have any impact on sales, what would be the critical values? use 0.05. question content area bottom part 1 a. 2.7765 b. 3.4954 c. 3.1634 d. 2.5706 which of the following are true about a strengths-based approach to motivation? check all that apply. an engineer enables packet screening in order to prevent any malicious activity over hypertext transfer protocol (http) web based traffic. which technology should the engineer utilize? Write a 4 paragraph about the pro and cons of Pasadena?Answer ASAP PLS Consider the following DNA fragment from four different suspects in a crime: Suspect 1 - ACGTACGGTCCGACCTT Suspect 2 - ACCTACGGCGGCGGTCCGACCTT Suspect 3 - ACATACGGTCCGACCTT Suspect 4 - ACGTACGGCGGTCCGACCTT Select all of the true statement(s) about these suspects and their DNA. Check All That Apply This stretch of DNA contains one SNP. This stretch of DNA contains two SNPs. Suspect 2 has three copies of an SNP. Suspects 1 and 3 have the same number of copies of an STR. Suspect 2 has three copies of an STR. can i get help on this please i don't understand it so if someone can help i will give brainy Question 5. The graph represents the path of a rock thrown from the top of a cliff by a hiker:Determine what the key features of the curve represent in terms of the path of the rock. Some ways in which lack of energy supply affects societal development Use Newton's law of gravitation to determine the acceleration of an 85-kg astronaut on the International Space Station (ISS) when the ISS is at a height of 350 km above Earth's surface. The radius of the Earth is 6.37 x 10^6m. (GIVEN: MEarth = 5.98 x 10^24 kg The enthalpy of solution is defined as Hsolnv = Hsolute + Hsolvent + Hmix. Each of the terms on the right side of the equation are either endothermic or exothermic. Which answer properly depicts this. why do you think the allies did not respond to the genocide of jews in countries under nazi control? The highest and the lowest rate of diffusion, respectively of the following six gases at 25C ? O2 CH4 SO3 Cl2 CO2 A 503 & 02 B. CH4 & 503 C CO2 8 Xe D. CH4 & Xe E. CO2 & Cl2 : In Principles that guide process, it is stated that we should examine our approach to development and be ready to change it as required. Which of the 8 principles focuses on that fact? 1 & 2 1 & 3 1 & 3 & 8 none of the above Can you help with that please Explain how your results would be different if you had used a 300 line per millimeter grating compared to a 600 line per millimeter. If it is critical that you measure the wavelength precisely forgiven lamp which of the following grading would you use 800 lines per centimeter 400 lines per centimeter centimeter or a hundred lines per centimeter? The constant dividend growth model may be used to find the price of a stock in all of the following situations except:Question 14 options:when the expected dividend growth rate is less than the discount rate.when the expected dividend growth rate is negative.when the expected dividend growth rate is zero.when the expected dividend growth rate is more than the expected return.the constant growth model works in all known circumstances, it never fails. _____ refers to the absorption of minority groups into dominant culture, while _____ reflects when minority groups retain their distinct cultural identity. A rectangle has an area of 114cm squared and a perimeter of 50 cm. What are its dimensions