Which letter represents the colony of New Jersey on the map?

Which Letter Represents The Colony Of New Jersey On The Map?

Answers

Answer 1

Answer: D

Explanation: If we remember, New Jersey borders New York in the north and northeast, Delaware, across Delaware Bay, in the south and southwest, and Pennsylvania in the west. I hope this helped.


Related Questions

What is the Three-Fifths Compromise?
A. A compromise that counted 3/5ths of the enslaved populations as representation and taxation
B. A compromise that allowed enslaved humans to be free after 1808.
C. A compromise that counted 3/Sths of the enslaved populations as only representation, giving the South more political power,
D.A compromise that would not ban the slave trade until 1808.

Answers

Answer- C

Explanation- the 3/5th compromise was used to count the slave population as 3/5th of a person and in that giving the south just enough political power over the north

Who were friars?

Members of the clergy who lead the dioceses

Germanic tribes who conquered parts of Rome

Church members who did not minister or lead

Monks who traveled abroad and preached

Answers

C) Just took the test

Why was plutonium production important in the early days of the [Hanford] site? Check all that apply.

A) It was used to manufacture guns and ammunition.
B) It was the first step in the process of making uranium.
C) It was used to produce power at the Grand Coulee Dam.
D) It helped the United States and its allies win World War II.
E) It was an important ingredient for building an atomic bomb.

Answers

Answer:

D and E

Explanation:

I got it right on edgen2021.

Answer:

Answers are D and E

Explanation:

A) It was used to manufacture guns and ammunition.

B) It was the first step in the process of making uranium.

C) It was used to produce power at the Grand Coulee Dam.

D) It helped the United States and its allies win World War II.√

E) It was an important ingredient for building an atomic bomb.√

4. Minister of finance. Believed in mercantilism. Tried to make France self-sufficient
I

Answers

Answer:

Colbert believed in the theory of Mercantilism. To prevent wealth from leaving the country, Colbert tried to make France self-sufficient.

Explanation:

PLS HELP!!!!!! Which was not a result of the Emancipation Proclamation?

keeping Britain from supporting the Confederacy

providing for the recruitment of blacks into the military

freeing slaves in the border states

changing the meaning of the war

Answers

Answer:

The Emancipation Proclamation was an executive order issued by Abraham Lincoln on January 1, 1863. It proclaimed the freedom of slaves in the ten Confederate states still in rebellion. It also decreed that freed slaves could be enlisted in the Union Army, thereby increasing the Union's available manpower.

Explanation:

I THINK THIS IS THE RIGHT ONE

Freeing slaves in the border states was not a result of the Emancipation Proclamation. Lincoln exempted the border states from the proclamation because he didn’t want to tempt them into joining the confederacy.

why did going to france to fight make them more motivated to fight for rights in the US?? ​

Answers

Answer: Because of the trading

Explanation:

g

What was the main reason France decided to fight for American independence?
Personal Gain - The allies hoped to regain some of the territory they had lost during the Seven Years' War as well as gain a new trade partner in the United States. 4. Belief in Freedom - Some people in Europe related to the American fight for independence. They wanted to help free them from British rule.
www.ducksters.com › history › ame...
American Revolution: Allies (The French) - Ducksters

What is the definition of the Mexican-American War?

Answers

Answer: Mexican-American War, also called Mexican War, Spanish Guerra de 1847 or Guerra de Estados Unidos a Mexico (“War of the United States Against Mexico”), war between the United States and Mexico (April 1846–February 1848) stemming from the United States' annexation of Texas in 1845 and from a dispute over whether Texas ...

Explanation:

Answer: The Mexican–American War, also known in the United States as the Mexican War and in Mexico as the Intervención Estadounidense en México, was an armed conflict between the United States and Mexico from 1846 to 1848

Where was Mansa Musa traveling to during his great hajj?

Answers

Answer:

Cairo

Explanation:

Traveling from his capital of Niani on the upper Niger River to Walata (Oualâta, Mauritania) and on to Tuat (now in Algeria) before making his way to Cairo, Mansa Mūsā was accompanied by an impressive caravan consisting of 60,000 men including a personal retinue of 12,000 enslaved persons, all clad in brocade and Persian silk.

Answer:

Where was Mansa Musa traveling to during his great hajj?

Explanation:

The fame of Mansa Musa and his phenomenal wealth spread as he traveled on his hajj to Mecca. Afterward, he put himself and his kingdom West Africa's Mali on the map literally.

PLSSS HELPPPP I WILLL GIVE YOU BRAINLIEST!!!!!! PLSSS HELPPPP I WILLL GIVE YOU BRAINLIEST!!!!!! PLSSS HELPPPP I WILLL GIVE YOU BRAINLIEST!!!!!! PLSSS HELPPPP I WILLL GIVE YOU BRAINLIEST!!!!!!
PLSSS HELPPPP I WILLL GIVE YOU BRAINLIEST!!!!!! PLSSS HELPPPP I WILLL GIVE YOU BRAINLIEST!!!!!! PLSSS HELPPPP I WILLL GIVE YOU BRAINLIEST!!!!!!

The Explorers' Legacy - After a wet and hungry winter in Oregon, the explorers headed home and finally returned to St. Louis in September 1806, two years and four months after setting out. Lewis proudly wrote to Jefferson, “In obedience to our orders, we have penetrated the Continent of North America to the Pacific Ocean.”

Lewis and Clark had good reason to be proud. Although they had not found the Northwest Passage—for it did not exist—they had traveled some 8,000 miles and had mapped a route to the Pacific. They had established good relations with western Indians. Most of all, they had brought back priceless information about the West and its peoples.

Of their many goals, which one were they not able to accomplish and why?

Answers

Answer:

Northwest Passage

Explanation:

it says in the passage that it did not exist so they cold not accomplish it.

help help i need help plzzzzzzzzzzzzzzzzz! Earn 30 points if you answer this question with an answer that well answer this problem plzz help!!

Answers

Roman gods and goddesses were named after objects and did not possess a gender, whereas Greek gods were decided by human characteristics and traits. As Greek gods predated Roman gods, Roman mythology would take the Greek deity and assign a Roman object that would fit the description of the Greek god.

True or false the 12 tables were created during the Pax Romana.

i’m just making sure my answer is correct

Answers

False. It was created in ancient Roman law. Well that’s what I had been told. Sorry if it was wrong. Have a great day!

What was the time frame of Japan's surrender after the atomic bombs were used? * 1 point 2 hours 1 week 2 months 1 year

Answers

Answer:

Option: 1 week

Explanation:

To stop Japan from the Second World War, America came up with an idea by bombing Japanese cities. The intention was to drop the bombs on populated cities. The bombing would ultimately force the Japanese army to surrender. America decided to drop the atomic bomb on Hiroshima on August 6 and Nagasaki on August 9. It was on August 10, Emperor Hirohito accept the terms of the Potsdam Declaration and transmitted a response to the Allied through the Japanese Foreign Ministry.

how does paragraph 16 help the reader understand gliding from to fly like the hawk and the eagle

Answers

To identify the central themes of a paragraph we must look at the details of its content.

What is a paragraph?

A paragraph is a term that refers to a communicative unit made up of a set of sentences on the same topic.

Generally, the sentences that make up a paragraph have a certain thematic unity (coherence). Another highlight of paragraphs is that they start with a capital letter and end with a full stop.

How to identify the topic of a paragraph?

To identify the theme of a paragraph we must read it several times and take notes on the thematic axes that it is enunciating. For example, a paragraph about the flight of birds such as the eagle and the Hawk and its relationship with gliding.

In this paragraph, different thematic axes could be identified, such as:

Soaring birds.Necessary movements to fly.Aspects in common between the Eagle and the Hawk.How do birds fly?What is gliding?

Note: This question is incomplete because the paragraph is missing. However I can answer it based on my general prior knowledge.

Learn more about paragraphs in: https://brainly.com/question/24460908

How did a wealth gap occur
during urbanization? Was this
avoidable? Why or why not?

Answers

Answer:

Notably, the recent rise of wealth inequality is almost entirely due to the rise of the share of wealth held by the top 0.1% – which went from 7% in 1979 to 22% in 2012. ... Third, the increased concentration of wealth at the top is driven by diversified wealth accumulation and surging (top) incomes.

Explanation:

true or false - the crusades were the holy wars from control of jerusalem​

Answers

True - the crusades were the holy wars controlled by Jerusalem

Pôs-nos mal Castela com todas as nações [...], as rendas das alfândegas faltaram, as mercadorias encareceram. [...] Diminuíram as naus da Índia [...]. As nossas fortalezas andavam tão mal providas que as tomavam os inimigos, como se viu na Baía, Pernanbuco, Mina, Ormuz, etc

Answers

Answer: what does this say

Explanation:

Imagine you are a scientist, working at betty crocker institute on how to cook good. You are tasked with coming out with a new model of baking dish. your materials for making the baking dish are covalent compounds like plastic, and ionic compounds like plaster. which material would you make the baking dish out of and why?

Answers

Answer:

iron ion

Explanation:

because plastic can melt when baking with it and when we eat plastic we get heart diseases and so on . so i prefer iron ion because it is a metal which will not melt off faster and actually iron is good for health because it makes are bones stronger but not too much because too much of any thing is bad .

The untouchables worked as servants, craftsmen, and laborers.
A. False
B. True

Answers

Answer:

false

Explanation:

falsee


the untouchables were not able to work as servants

can someone help? The Roman Empire was able to expand through?

force
cooperation
compromises
alliances

Answers

Answer:

force

Explanation:

PLEASE HELP
This quote is from the article, "A Profitable Business". In a few sentences, explain the importance of the quote:
Take care of sheep, and they'll take care of you.

Answers

I will assume that the article has to do with economics. The quote likens a business boss to a Shepard, and employees to sheep. The better that a boss takes care of his workers, the higher returns he will receive business-wise. When treated fairly, workers are more likely to work harder and therefore return more profit.

Why was the Battle of Gettysburg so important to the entire Civil War?
(A) That was where the Civil War ended.
(B) That was where the Civil War began.
(C) The tide of the War turned at Gettysburg.
(D) That was where General Robert E. Lee was born.

Answers

Answer:

its a

Explanation:

Answer: c

Explanation:

How is Harriet Tubman singing the forbidden spiritual symbolizing to the enslaved people to whom Harriet Tubman is signaling

Answers

Answer:

She was using these spiritual songs to convey messages to the enslaved

Explanation:

During their enslavement, harriet tubman and the enslaved people used spiritual songs as secret languages for sharing informations amongst themselves.

During their escape to the north through the underground railroad,codes were used in the songs they sang as a means of communication without the slave owners being aware. So tubman used these spirituals as code to tell her fellow slaves of her plans.

why was The soviet invasion of hungary significant to the cold war

Answers

Answer:

Bc it sparked a fight between the two thus ended up fighting

why did the French begin the revolution in 1791. you can find your answers in here ​

Answers

Answer:

Explanation:

If the answer can be found in that small paragraph, I would say because of slavery? Not all the way sure- sorry! <3

-Oceaniii

which phrase best describes Germany's emotional reaction to the Treaty of Versailles?

Answers

Answer:

Humiliation and resentment after losing all and any control and power :)

Answer:

humiliation and resentment for losing power and having to pay damages!

Explanation:

How did Leland Melvin change the face of science

Answers

Answer:

Leland is the only person drafted into the National Football League to have flown in space. The Pro Football Hall of Fame honored his athletic and academic accomplishments by placing his Detroit Lions jersey under glass in Canton, Ohio. Through these professional experiences working on high stakes teams he developed a deep and nuanced understanding of effective team dynamics.

Leland has a Bachelor of Science degree in chemistry and a Master’s degree in materials science engineering. He worked at NASA Langley Research Center in the area of nondestructive testing creating optical fiber sensors for measuring damage in aerospace vehicles, resulting in publications in numerous scientific journals. After hanging up his space boots he was appointed head of NASA Education and served as the co-chair on the White House’s Federal Coordination in Science, Technology, Engineering, and Mathematics (S.T.E.M.) Education Task Force developing the nation’s 5-year STEM education plan. Leland was the United States representative and chair of the International Space Education Board (ISEB), a global collaboration on learning about space. He uses his life story as an athlete, astronaut, scientist, engineer, photographer, and musician to help inspire the next generation of explorers to pursue Science, Technology, Engineering, Art, and Mathematics (S.T.E.A.M.) careers.

Explanation:

Why did early farmers in the Andes mountains have to developed terrace farming?
1. Because the area did not get much rain
2. Because no wild plants grew in the area
3. Because wild animals destroyed any other farms
4. Because the mountains were very steep

Answers

Answer:

1. Because the area did not get much rain

Explanation:

The purpose of the terrace is to maximize arable lands and prevent erosion and water loss.

Early farmers in the Andes mountains developed terrace farming because the area did not get much rain, and the terraces helped to conserve water and prevent erosion, allowing crops to be grown successfully. Therefore, option 1 is correct.

What is terrace farming?

Terrace farming, also known as step farming or terrace cultivation, is a method of farming that involves building a series of flat, horizontal platforms, or terraces, into a steep slope or hillside.

This creates a series of steps, allowing crops to be grown on a gradient. Terrace farming is commonly used in mountainous regions where land is limited and often too steep to farm conventionally. It has been used for thousands of years in different parts of the world, including Asia, Africa, and South America.

Terrace farming has many benefits, including preventing soil erosion, conserving water, and maximizing land use. It also allows farmers to grow crops in areas that would otherwise be too steep or inaccessible.

Learn more about terrace farming here:

https://brainly.com/question/17379906

#SPJ3

.
What are the benefits of using an assembly line?

Answers

Explanation:

ehvvhjj jfn jej jjej jrj u j3j jcjej j jkek isqpvjfuqpcjdi

Answer:The primary benefit of assembly lines is that they allow workers and machines to specialize at performing specific tasks, which can increase productivity. Large-scale assembly lines can allow for mass production of goods that would not be possible if products were made from start to finish by a single worker.

2. Is Germania north or south of Italia?

Answers

Answer:

. Germany is in Western and Central Europe, bordering Denmark in the north, Poland and the Czech Republic in the east, Austria and Switzerland in the south, France and Luxembourg in the south-west, and Belgium and the Netherlands in the north-west.

Explanation:

Stay safe, stay healthy and be blessed.

Thank you

When Mexico became an independent nation they outlawed slavery
true or false?

Answers

Answer:

i would say false

Explanation:

Answer:

False.

Explanation:

Mexico became independent in 1810, but there was still some slavery. A few years after 1929 is when slavery in Mexico really expanded.

Other Questions
The solubility of calcium phosphate is 2. 21 x 10- 4 g/L. What are the molar concentrations of the calcium ion and the phosphate ion in the saturated solution? (Molecular wt of calcium phosphate = 310. 18 g/mole) A U.S. public company reported $8 million of goodwill in last year's balance sheet. How should the company calculate its reported goodwill for the current year?A. Determine whether the fair value of the reporting unit is less than the carrying amount and if so reduce the balance of goodwill and report an impairment loss on goodwill in the income statement.B. Calculate the yearly amortization, reduce the beginning balance, and report the current year's amortization expense.C. Determine whether the fair value of the reporting unit is greater than the carrying amount and if so increase the amount of goodwill and report the recovery of any previous impairment in the income statement.D. Determine whether the fair value of the reporting unit is greater than the carrying amount and if so increase the balance of goodwill and report a gain on goodwill in the income statement. c does not provide complete support for abstract data types What is the range of the circle above? earlier debates about divorce concerned the well-being of young children whose lives were disrupted by divorce. in the near future, debates about divorce will likely focus on ________. For the most part, the people who left Europe to settle elsewhere were In ____________________ connections, your computer dials up and connects to your ISP's computer only when needed.A. AepanetB. BroadbandC. Dial-upD. Bandwidth cheng is making a trip to her safe deposit box. what is she most likely planning to do?group of answer choices suppose the population of bears in a national park grows according to the logistic differentialdp/dt = 5P - 0.002P^2where P is the number of bears at time r in years. If P(O)-100, find lim Po) A study of blood pressure and age compares the blood pressures of men in three age groups: less than 30 years, 30 to 55 years, and over 55 years. Select the best method to analyze the data. a. Wilcoxon rank sum test b. Mann-Whitney test c. Kruskal-Wallis test d. Wilcoxon signed rank test Suppose that you borrow $10,000 on a 60-month car loan at 6.25% APR. Compute the monthly payment. a. Set up an equation for the problem using the following variables: n i pv pmt fv; where n=number of periods and i= interest rate per periodWhat is the actual formula?Does this one work? Part of a homeowner's insurance policy covers one miscellaneous loss per year, which is known to have a 10% chance of occurring. If there is a miscellaneous loss, the probability is c/x that the loss amount is $100x, for x = 1, 2, ...,5, where c is a constant. These are the only loss amounts possible. If the deductible for a miscellaneous loss is $200, determine the net premium for this part of the policythat is, the amount that the insurance company must charge to break even. if the enzyme-catalyzed reaction e s es e p is proceeding at or near the vmax of e, what can be deduced about the relative concentrations of s and es What is the floor of the House and Senate chambers?1. the place in each chamber where members of Congress vote on whether bills should be laws2. the place in each chamber where members of Congress stand to talk to constituents3. the place in each chamber where members of Congress give speeches about bills4. the place in each chamber where members of Congress investigate the possible effects of a bill Minerals can be classified based on cleavage or fracture. These two properties refer to the way in which a mineral tends to break. Cleavage is an orderly breakage in well-defined planes. It means that the broken piece of mineral will have flat and smooth sides. Fracture is a random breakage. If a mineral breaks with rough, random, uneven surfaces, it is said to have fractured. Because each of your mineral samples have already been broken from another, larger piece of a mineral, you should be able to tell if it has cleavage or fractures by looking at its sides. Of your 10 minerals, identify three that experienced cleavage. a cube-shaped gray mineral with smooth faces and sharp edges,a rust-colored mineral with a rough, uneven surface In "Bowling Alone," Robert Putnam discusses the reduced amount of social activity and civic engagement among U.S. adults during the past 40 years. Democratic governance, some have argued, depends to some degree on civic engagement and the social capital that it engenders. Putnam advances a number of reasons for the decline in civic engagement or the increase in "Bowling Alone." A leading hypothesis is that television viewing a solitary activity has replaced social activity as a primary form of leisure activity. The article was written a while ago. Today, he might extend that hypothesis to include the extent to which social media replaces conversation and social activity. Building on this information, please answer the following questions.1. What is the dependent variable in the hypothesis regarding television viewing?2. What is the independent variable in the hypothesis regarding social media?3. What is the hypothesized direction of the association between the independent and dependent variable in the social media hypothesispositive, negative, null, or the direction of association cannot be determined?4. In a sentence or two, please explain your reasoning for your answer in c.5. What is the null hypothesis for the hypothesis regarding TV viewing and civic engagement? the sequence of part of an mrna transcript is 5augcccaacagcaagaguggugcccugucgaaggag3 what is the sequence of the dna coding strand? how are the shapes alikei need to know When performing a nutrition assessment, the practitioner should include what information as part of the patient's food and nutrition history? Using the article "You Trouble" discuss whether or not stunt videos cause teens to take risks and increase impulsive behavior