Which of the following is an example of a variable measured at the nominal level of measurement?
A. Location in which respondent was born
B. Religiosity measured as not religious, somewhat religious, and very religious
C. Time in seconds in which a subject completes a given task D. Number of respondents' first cousins
E. Level of education in years completed

Answers

Answer 1

Religion is an example of a variable measured at the nominal level of measurement. Thus, option B is correct.

Nominal values are those that cannot be quantified by numbers, such as when calculating age or tallying academic accomplishments. As opposed to the ordinal, interval, or ratio measurements, it is the level of measurement representing a variable that just has distinct properties.

Since the 'characteristic' or 'identity' we are interested in is just named, the nominal level of measurement is the least accurate and illuminating. In nominal variables, the numerical values just "label" the attribute in a distinctive way. The numerical value is just a label in this instance.

To learn more about the Nominal level of measurement,

https://brainly.com/question/4823744

#SPJ4


Related Questions

NEED THIS SOLVED ASAP!!!!!!!!!!!! I AM GIVING 15 POINTS

Arm Span (inches) / Height (inches)
58 60
49 47
51 55
19 25
37 39
44 45
47 49
36 35
41 40
46 50
58 61

Using graphing software of your choice, create a scatter plot of your data. Predict the line of best fit, and sketch it on your graph.
Copy and paste your scatter plot into a word-processing document. (Recommend me this software so I can do this part).

Using graphing software of your choice, create a scatter plot of your data. Predict the line of best fit, and sketch it on your graph.
Copy and paste your scatter plot into a word-processing document.

Answers

The scatter plot for the above data and it's line of best fit is attached accordingly. You may achieve this result using Microsoft Excel.

How to plot scatter plot on Microsoft Excel

Enter your data into two columns in an Excel worksheet. For example, in columns A and B, enter the years and corresponding life expectancies from your given data.

Select the data range by clicking and dragging over the cells containing the data.

Go to the "Insert" tab in the Excel ribbon.

In the "Charts" group, click on the "Scatter" chart type. Choose the scatter plot style that suits your preference (e.g., "Scatter with Straight Lines").

A scatter plot will be created on your worksheet.

Right-  click on any data point on the scatter plot and choose "Add Trendline" from the context menu.

In the  "Format Trendline" pane  that appears on the right side of the screen, select the "Linear"  trendline option.

Check the box for  "Display Equation on Chart" if you want to show the equation of the line of best fit on the  chart.

You can further customize the appearance of the scatter plot and the trendline using various chart formatting options in Excel.

Your scatter plot with the line of best fit is now plotted on Excel.

Learn more about scatter plot at:

https://brainly.com/question/29231735

#SPJ1

What is the quotient of the expression
O7a³ + ab + 3
O7a³ + ab - 3
O7a³ + 4ab+
+8
O7a³+4ab-8
28a b+4a²b²-12ab?
4ab

Answers

The quotient of the expression (7a³ + ab + 3) / (7a³ + ab - 3) divided by 4ab is (7/4a²) + (1/4b) + (3/4ab).

How to find the quotient

By dividing each term of the numerator by 4ab:

(7a³ + ab + 3) / (7a³ + ab - 3) ÷ 4ab

= (7a³ / 4ab) + (ab / 4ab) + (3 / 4ab)

Simplifying each term individually:

= (7/4a²) + (1/4b) + (3/4ab)

Thus, the quotient of the expression (7a³ + ab + 3) / (7a³ + ab - 3) divided by 4ab is (7/4a²) + (1/4b) + (3/4ab).

Learn more about quotient at https://brainly.com/question/11995925

#SPJ1

Question 5 Joy is a 52-year-old nurse who earns a salary of R286 500 per annum. She contributes 7% of her annua salary to a pension fund. She only has her 2 daughters listed as a dependents on her medical aid. Sh is concerned that the R4000 monthly income tax deduction is too much.​

Answers

Determine Joy's annual income tax liability. If the amount is significantly different from the R4000 monthly deduction, she may need to consult a tax advisor to ensure accurate tax planning.

To assess whether the monthly income tax deduction of R4000 is too much for Joy, we need to calculate her annual income tax liability and compare it to the deduction.

First, let's calculate the amount Joy contributes to her pension fund annually:

Pension fund contribution = 7% of annual salary

Pension fund contribution = 7/100 * R286,500

Pension fund contribution = R20,055

Next, we need to determine Joy's taxable income by subtracting her pension fund contribution from her annual salary:

Taxable income = Annual salary - Pension fund contribution

Taxable income = R286,500 - R20,055

Taxable income = R266,445

Now, we can calculate the income tax liability based on the South African income tax brackets for the 2023 tax year. Please note that tax brackets are subject to change, so it's essential to verify with the latest tax regulations.

According to the current tax brackets, the tax rates for the 2023 tax year are as follows:

18% on the first R216,200 of taxable income

26% on the portion of taxable income between R216,201 and R337,800

31% on the portion of taxable income between R337,801 and R467,500

36% on the portion of taxable income between R467,501 and R613,600

39% on the portion of taxable income above R613,601

Using these tax rates, we can calculate the income tax liability:

Tax liability = (18% * amount within first bracket) + (26% * amount within second bracket) + (31% * amount within third bracket) + (36% * amount within fourth bracket) + (39% * amount within fifth bracket)

First, let's calculate the amounts within each tax bracket:

Amount within first bracket = min(Taxable income, R216,200)

Amount within second bracket = min(max(Taxable income - R216,200, 0), R337,800 - R216,201)

Amount within third bracket = min(max(Taxable income - R337,800, 0), R467,500 - R337,801)

Amount within fourth bracket = min(max(Taxable income - R467,500, 0), R613,600 - R467,501)

Amount within fifth bracket = max(Taxable income - R613,600, 0)

Now, let's substitute the values and calculate the income tax liability:

Tax liability = (18% * min(Taxable income, R216,200)) + (26% * min(max(Taxable income - R216,200, 0), R337,800 - R216,201)) + (31% * min(max(Taxable income - R337,800, 0), R467,500 - R337,801)) + (36% * min(max(Taxable income - R467,500, 0), R613,600 - R467,501)) + (39% * max(Taxable income - R613,600, 0))

By calculating this equation, you can determine Joy's annual income tax liability. If the amount is significantly different from the R4000 monthly deduction, she may need to consult a tax advisor to ensure accurate tax planning.

for such more question on income tax

https://brainly.com/question/26316390

#SPJ8

19
Evaluate the following:
25 (23 +8÷4) +5
16
B) 20
27
D) 28

Answers

(Remember to use PEMDAS when showing your work) ANSWER: 20

pls pls help, will give brainliest answer!!

Answers

Answer:

Equation of the triangle:  (x + 74) + 73 + (37 + x) = 180°

Solve for x:  x = -2

Find the measure of angle A:  A = 35°

Step-by-step explanation:

Step 1:  We know that the 73° angle and the angle inside the triangle that lies opposite it are vertical angles ,so this angle is also 73° .

Step 2:  Similarly, the (x + 74)° angle and the angle inside the triangle that lies opposite it are also vertical angles, so this angle is also represented by the expressions (x + 74)°

Equation of the triangle:  The triangle sum theorem states that the sum of the interior angles of a triangle equals 180°.  Thus, the equation of the triangle is (x + 74) + 73 + (37 + x) = 180

Solving for x:  

Step 1:  Rearrange and combine like terms:

(x + 74) + 73 + (37 + x) = 180

(x + x) + (74 + 73 + 37) = 180

2x + 184 = 180

Step 1:  Subtract 184 from both sides:

(2x + 184 = 180) - 184

2x = -4

Step 3:  Divide both sides by 2 to solve for x:

(2x = -4) / 2

x = -2

Finding the measure of angle A:  Now we can plug in -2 for x in the expression representing the measure of angle A to find the actual measure:

A = 37 - 2

A = 35

Thus, the measure of angle A is 35°.

Optional Step:  We can check that our equation of the triangle, the value we've found for x, and the measure of angle A is correct by simply plugging in -2 for x in the equation of the triangle and checking that we get 180 on both sides:

(-2 + 74) + 73 + (37 - 2) = 180

72 + 73 + 35 = 180

145 + 35 = 180

180 = 180

Thus, all of our answers are correct.


1/5 ( x - 10 ) = 4/5

Answers

The value of x is 14

What are fractions?

Fractions are described as expression that shows the part of a whole number, a whole variable. a whole element.

The different types of fractions are listed as;

Improper fractionsProper fractionsMixed fractionsSimple fractionsComplex fractions

From the information given, we have that;

1/5 ( x - 10 ) = 4/5

This is written as;

(x -10)/5 = 4/5

cross multiply the values, we have;

5(x-10) = 20

expand the bracket

5x - 50 = 20

Collect like terms

5x = 70

Divide the values

x =14

Learn more about fractions at: https://brainly.com/question/11562149

#SPJ1

What is the equation of the line that passes through (4, 3) and (-4, -1)?

Choices:
2x+1
y=2x+7
y=x/2 +1
y= -x/2 +7

Answers

The equation of the line that passes through (4, 3) and (-4, -1) is y = -x/2 + 5. So, correct option is A.

To find the equation of the line that passes through two given points, we use the slope-intercept form of a linear equation, which is:

y = mx + b

where m is the slope of the line and b is the y-intercept.

First, we need to find the slope of the line using the two given points. The formula for finding slope between two points is:

m = (y₂ - y₁) / (x₂ - x₁)

where (x₁, y₁) and (x₂, y₂) are the coordinates of the two points.

Substituting the given points into the formula, we get:

m = (-1 - 3) / (-4 - 4) = -4/8 = -1/2

Now we know the slope, we can use one of the given points (4, 3) and substitute the slope into the slope-intercept form of the equation and solve for b.

y = mx + b

3 = (-1/2)(4) + b

3 = -2 + b

b = 5

Therefore, the equation of the line that passes through (4, 3) and (-4, -1) is:

y = -x/2 + 5

So, correct option is A.

To learn more about equation click on,

https://brainly.com/question/29255626

#SPJ1

Complete question is:

What is the equation of the line that passes through (4, 3) and (-4, -1)?

Choices:

y = -x/2 + 5

y=2x+7

y=x/2 +1

y= -x/2 +7

Solve (540x45) +(540x 55) using suitable property. And mention the name of the
property used

Answers

Step-by-step explanation:

(540×45) + ( 540×55)

(24300) +(29700)

54000

Answer:

540*45+540*55=540*45=24300 540*55=29700=24300+29700=54000

Step-by-step explanation:

by solving the the first bracket to get the answer then the other one, after getting the both answer, then add it together

Katrina wants to make a cover for her laptop to fit into her bag in order to protect it. She measured the top of her laptop and found it was 57,000 mm2. “No one sells covers using square millimeters,” her friend noted. Describe the area of the top of Katrina’s laptop using square centimeters.​

Answers

Answer:

To convert square millimeters to square centimeters, we need to divide the area in square millimeters by 100 (since there are 100 square millimeters in a square centimeter).

So, the area of the top of Katrina's laptop in square centimeters would be:

57,000 mm² ÷ 100 = 570 cm²

Therefore, the area of the top of Katrina's laptop in square centimeters is 570 cm².

4. Higher Order Thinking A national TV
news show conducted an online poll to find
the nation's favorite
comedian. The
website showed
the pictures of
5 comedians and
asked visitors of the
site to vote. The news
show inferred that
the comedian with
the most votes was
the funniest comedian
in the nation.


a. Is the inference valid? Explain.



b. How could you improve the poll? Explain.

Answers

No, the inference is not necessarily valid. The fact that a comedian received the most votes in an online poll does not guarantee that they are the funniest comedian in the nation.

Is the inference valid? Explain.

The poll's results are influenced by various factors such as the sample size, the demographics of the voters and potential biases in the voting process.

Also, humor is subjective and what one person finds funny may not be the same for someone else. Therefore, determining the funniest comedian based solely on the number of votes in an online poll is an oversimplified and flawed approach.

To improve the poll, several steps can be taken which are:

Increase sample sizeUse random samplingImplement multiple criteriaConduct a live event or competition.

Read more about inference

brainly.com/question/25913650

#SPJ1

least common denominator of -3/a and 1/4a^2

Answers

Answer:

-12a-1/4a2

Step-by-step explanation:

A ball pit contains 190 balls.
50 are orange, 100 are purple and 40 are yellow.
What is the ratio of yellow to purple balls in its simplest form?

Answers

Step-by-step explanation:

40 :100        yellow to purple,  divide both sides by 20

2:5

Answer:

the ratio of yellow to purple is 40:100 that is 2:5 in the simplest form.

Step-by-step explanation:

Hope it helps.

Lines y and z are parallel.
Parallel lines are cut by transversals s and t. The angles formed by lines s, t, and y, clockwise from top left, are blank, blank, (10 x + 5) degrees, blank, (4 x minus 7) degrees, blank; formed by s and z are 65 degrees, 1, blank, blank; formed by z and t are 2, blank, blank, blank.
What is the measure of angle 2?
6 degrees
11 degrees
28 degrees
37 degrees

Answers

The measure of Angle 2 is 17 degrees.

The measure of angle 2,  the relationships between the given angles formed by the parallel lines and transversals.

1. The angles formed by lines s, t, and y, clockwise from top left, are:

  - Blank

  - Blank

  - (10x + 5) degrees

  - Blank

  - (4x - 7) degrees

  - Blank

2. The angles formed by s and z are:

  - 65 degrees

  - 1

  - Blank

  - Blank

3. The angles formed by z and t are:

  - 2

  - Blank

  - Blank

  - Blank

From the given information, we can deduce the following:

- Angle 1 is congruent to the angle formed by z and t (corresponding angles).

- Angle (10x + 5) degrees is congruent to angle 65 degrees (alternate interior angles).

- Angle (4x - 7) degrees is congruent to angle 2 (alternate interior angles).

Therefore, we can set up the following equations:

65 = 10x + 5     (Equation 1)

2 = 4x - 7       (Equation 2)

Solving Equation 1:

65 - 5 = 10x

60 = 10x

x = 6

Substituting x = 6 into Equation 2:

2 = 4(6) - 7

2 = 24 - 7

2 = 17

Hence, the measure of angle 2 is 17 degrees.

Therefore, the correct answer is:Angle 2 = 17 degrees.

To know more about Angle .

https://brainly.com/question/30759856

#SPJ11

Help me please! Thanks

Answers

The identification of the polygon that are given in the diagram above would be =

Polygon 1 = Isosceles trapezoid

polygon 2 = parallelogram

polygon 3 = Rectangle

polygon 4 = Rhombus

polygon 5 = Square

polygon 6 = trapezoid

What are the properties of the polynomials given above?

Isosceles trapezoid : This is the type that of polygon in which the the top and base are not equal in length, but they are parallel to each other.

Parallelogram : This is defined as the type of polygon that has two pairs of parallel sides.

Rectangle : This has two pairs of sides that are equal and opposite.

Rhombus: All the sides are equal in length with its opposite angles equal .

Square: All sides are equal in length but and all angles are equal to 90°.

Learn more about polygon here:

https://brainly.com/question/26583264

#SPJ1

A fruit stand sells 5-pound bags of oranges for $3.00 each. There are 15 oranges in each bag. What is the price per orange?

Answers

Answer:

$0.20 per orange

Step-by-step explanation:

We Know

A fruit stand sells 5-pound bags of oranges for $3.00 each.

There are 15 oranges in each bag.

What is the price per orange?

We Take

3 / 15 = $0.20 per orange

So, the price per orange is $0.20

Copy and complete the pattern in the table

Answers

The pattern in the table should be completed as follows;

Number of                      1          3        9       27        81

students with pets

Total number                  3         9        27     81        243

of students

A ratio that compares the number of blue squares to the total number of squares is 3 : 4.

What is a proportional relationship?

In Mathematics and Geometry, a proportional relationship can be modeled or represented by the following mathematical equation:

y = kx

Where:

y represents the x-variable​.x represents the y-variable.k is the constant of proportionality.

Next, we would find the constant of proportionality (k) by using various data points as follows:

Constant of proportionality, k = y/x

Constant of proportionality, k = 3/1 = 9/3

Constant of proportionality, k = 3.

y = 3x

81 = 3x

x = 27

x = 9/3

x = 3

y = 3(81)

y = 243

For the ratio of blue squares to total squares, we have:

18/24 = 3/4 = 3 : 4

Read more on proportional relationship here: brainly.com/question/28350476

#SPJ1

Halle planted mint and basil seeds in her herb garden. She measured the height of each herb plant at the end of each week for six weeks. The results are shown in the line graph below.


What is the difference to the nearest tenth in the mean growth per week for both herbs during the six weeks shown in the graph?
A. 0.7cm/week
B. 0.6cm/week
C. 3.7cm/week

Answers

The difference in mean growth per week is 3.7cm/week

From the graph given :

Growth per week for Basil = 2, 6, 9, 10, 14, 16

Growth per week for Mint = 1, 2, 4, 7, 9, 12

Mean growth per week = (2+6+9+10+14+16) / 6 = 9.5 cm/week

Mean growth per week (Mint) = (1+2+4+7+9+12)/6 = 5.83 cm/week

The difference cannbe obtained by subtracting the mean Values thus ;

Difference in average growth = 9.5 - 5.83 = 3.67 cm/week

Therefore, the difference in mean growth per week is 3.7cm/week

Learn more on average ; https://brainly.com/question/130657

#SPJ1

How can graph coloring be applied in real-world situations, and what are the challenges and limitations associated with using graph coloring algorithms? Provide specific examples to support your answer.

Answers

Answer:

Graph coloring is a widely used concept in real-world situations, particularly in computer science and engineering. It involves assigning colors to the vertices of a graph, with no adjacent vertices having the same color. One real-world application of graph coloring is in scheduling problems, where tasks must be assigned to resources such as workers or machines, with the constraint that no two tasks requiring the same resource can be scheduled at the same time. Another application is in map coloring, where regions on a map are assigned colors in such a way that no two adjacent regions have the same color.

Challenges and limitations associated with using graph coloring algorithms include the exponential increase in computation time as the size of the graph increases, making it difficult to apply the algorithm to very large graphs. Additionally, some graph coloring problems may be NP-hard, meaning that no polynomial-time algorithm is known that can solve them for all possible inputs. This can make it challenging to find an optimal solution, and instead approximate solutions may need to be used.

For example, in telecommunication networks, channel assignment is a common problem of graph coloring. In mobile networks, different channels must be assigned to different cells to avoid interference and ensure efficient use of resources. The channel assignment problem can be formulated as a graph coloring problem, where the vertices represent cells and the edges represent interference.

Another example is in scheduling of sports leagues. In this case, teams are assigned to play on different days and times in such a way that no two teams play against each other more than once and no team plays two games on the same day. This can be formulated as a graph coloring problem, with vertices representing teams and edges representing games between teams.

In conclusion, graph coloring algorithms have numerous real-world applications. While there are challenges and limitations associated with these algorithms, they continue to be an important tool for solving optimization problems in a wide range of fields.

Step-by-step explanation:

17. Find m2NSR=
Segment AB is tangent to circle C. Find r.
18. r=
176
40°
35
25
Need help. Please show work and answer 17 and 18

Answers

1. The value of angle NSR is 110°

2. The value of r 12

What is arc angle relationships?

If two secants or chords intersect inside a circle, then the measure of the angle formed is equal to half the sum of the measures of the intercepted arcs.

Therefore;

S = 1/2( 170+40)

S = 1/2 ( 210)

S = 110

Therefore the value of angle NSR is 110°

2. There is a theorem that states that the angle between a radius and tangent is 90°

Using Pythagorean theorem

(25+r)² = r² +35²

= 625 + 50r + r² = r² +35²

625 +50r = r² - r² +35²

50r = 1125-625

50r = 600

r = 600/50

r = 12

therefore the value of r is 12

learn more about arc angle relationship from

https://brainly.com/question/31704687

#SPJ1

Currently it is estimated that 3 out of every 1000 Californians are infected with
coronavirus. The so-called rapid "antigen" test for coronavirus has a very low false
positive rate of just 0.05, but has a high false negative rate of 0.2. The so-called
PCR test is more reliable: it has an even lower false positive rate than the antigen
test, namely only 0.001, but even more importantly its false negative rate is much
lower at 0.01.
What is the probability that you have a coronavirus infection conditional on your
PCR test has coming back positive?

Answers

The probability that an antigen test comes back positive is approximately 0.05225, or about 5.225%.

We have,

To find the probability that an antigen test comes back positive, we need to consider both the true positive rate (probability of a positive test given that the person is infected) and the false positive rate.

Now,

Prevalence of coronavirus in California: 3 out of 1000

False positive rate of the antigen test: 0.05 (5 out of 100)

Let's calculate the probability of a positive test result.

The true positive rate can be calculated as 1 minus the false negative rate (probability of a negative test given that the person is infected):

True positive rate = 1 - 0.2 = 0.8 (or 80 out of 100)

The probability of a positive test result can be calculated using Bayes' theorem:

P(Positive test) = P(Positive test | Infected) x P(Infected) + P(Positive test | Not Infected) x P(Not Infected)

P(Positive test) = (0.8 x 3/1000) + (0.05 x 997/1000)

P(Positive test) = 0.0024 + 0.04985

P(Positive test) = 0.05225

Therefore,

The probability that an antigen test comes back positive is approximately 0.05225, or about 5.225%.

Learn more about probability here:

brainly.com/question/14099682

#SPJ1

Calculate the unknown length, x, in the shape below.
If your answer is a decimal, give it to 1 d.p.
8
8 cm
area = 55 cm²
area=178.2 cm²
15 cm

Answers

The triangles are similar triangles. Then the value of 'x' will be 27 cm.

The polygonal shape of a triangle has a number of sides and three independent variables. Angles in the triangle add up to 180°.

The ratio of the matching sides will remain constant if two triangles are comparable to one another.

From the above theorem, the equation is given as,

(x/15)² = 178.2 / 55

Simplify the equation, then we have

(x/15)² = 3.24

x/15 = 1.8

x = 27 cm

More about the triangle link is given below.

https://brainly.com/question/25813512

#SPJ1

Use the graph to answer the question.

Graph of polygon ABCD with vertices at negative 2 comma negative 1, 0 comma negative 4, 4 comma negative 4, 2 comma negative 1. A second polygon A prime B prime C prime D prime with vertices at 5 comma negative 1, 7 comma negative 4, 11 comma negative 4, 9 comma negative 1.

Determine the translation used to create the image.

7 units to the right
3 units to the right
7 units to the left
3 units to the left

Answers

The translation used to create the image of the second polygon is A, 7 units to the right.

How to determine translation?

To determine the translation used to create the image of the second polygon (A' B' C' D') from the original polygon (ABCD), compare the corresponding vertices.

Original polygon (ABCD):

A (-2, -1)

B (0, -4)

C (4, -4)

D (2, -1)

Image polygon (A' B' C' D'):

A' (5, -1)

B' (7, -4)

C' (11, -4)

D' (9, -1)

To find the translation, calculate the horizontal and vertical differences between the corresponding vertices.

Horizontal difference:

For point A: A'x - Ax = 5 - (-2) = 7

For point B: B'x - Bx = 7 - 0 = 7

For point C: C'x - Cx = 11 - 4 = 7

For point D: D'x - Dx = 9 - 2 = 7

Vertical difference:

For point A: A'y - Ay = -1 - (-1) = 0

For point B: B'y - By = -4 - (-4) = 0

For point C: C'y - Cy = -4 - (-4) = 0

For point D: D'y - Dy = -1 - (-1) = 0

From the calculations, see that the horizontal difference is 7 units for all the corresponding vertices, while the vertical difference is 0 units for all the corresponding vertices.

Therefore, the translation used to create the image of the second polygon is 7 units to the right.

Find out more on polygon here: https://brainly.com/question/1592456

#SPJ1

Mathematical form of the question:

Use the graph to answer the question.

Graph of polygon ABCD with vertices at A (-2, -1), B (0, -4), C (4, -4), D (2, -1). A second polygon A' (5, -1), B' (7, -4), C' (11, -4), D' (9, -1).

Determine the translation used to create the image.

7 units to the right

3 units to the right

7 units to the left

3 units to the left

Help with my school work, I spend 80 points on this question. I will give brainiest for correct answer.

If 1 + 2 = 3, then why does 4 + 5 not = 6?
And if 2 x 2 = 4, then why does 4 x 4 not = 8?

Answers

Answer:

Because equations is not counting, and multiply is not addition.  

Step-by-step explanation:

Addition is: a process of combining two or more numbers. Addends are the numbers being added, and the result or the final answer we get after the process is called the sum. It is one of the essential mathematical functions we use in our everyday activities. There are many situations in which we add numbers.

Like lets say you have 1 apple, and your friend gives 2 more, then you have 3. If you have 4 apples, and your friend gives 5 more, then you have 9 apples.

Its always better to start with the bigger number, it makes it easier, like 2 + 1 = 3, or 5 + 4 = 9.

Now multiplication is harder. Multiplication is: the basic explanation of multiplication is adding a number, with respect to another number, repeatedly. For example, if we are multiplying 2 by 3, that means 3 is added to itself two times, i.e. 3 + 3 = 6. This is a simple technique for kids to multiply numbers.  

(Answer) 2 x 2 would equal 4. (Explanation) Add a 2, with respect to 2, repeatedly, would equal 4.

(Answer) 4 x 4 would equal 16. (Explanation) Add a 4, with respect to 4, repeatedly, would equal 16.

I hope it helps you out!Mark me as brainiest please.  

HAVE A GREAT REST OF YOUR DAY/NIGHT!!!

Answer: Step-by-step explanation:

because 1 + 2  does equal 3 but 4 + 5 does not equal to 6 because it equals to 9.

and 2 x 2  does equal to 4 but 4 x 4 does not equal to 8 because it equals to 16.

Mark me brainiest pls.Have good day.

Find the area of the parallelogram with given points.
(7,4)
(3,0)
(-4,9)
(13,0)

Answers

The area of the parallelogram with given points is 8√26 or 40.79 square units.

How to calculate the area of this parallelogram?

In Mathematics and Geometry, the area of a parallelogram can be calculated by using the following formula:

Area of a parallelogram, A = b × h

Where:

b represents the base area of a parallelogram.h represents the height of a parallelogram.

Height = √[(x₂ - x₁)² + (y₂ - y₁)²]

Height = √[(3 - 7)² + (0 - 4)²]

Height = √32 units.

Base = √[(13 - 7)² + (0 - 4)²]

Base = √52 units

By substituting the given parameters into the formula for the area of a parallelogram, we have the following;

Area of a parallelogram = √32 × √52

Area of a parallelogram = 8√26 or 40.79 square units.

Read more on parallelogram here: brainly.com/question/4459854

#SPJ1

Why can you not have 1 imaginary solution?

Answers

You cannot have 1 imaginary solution because the quadratic equation must have either two real solutions or two complex solutions

What is an imaginary solution?

In mathematics, the discriminant (D = b2 - 4ac) aids in identifying the kind of solutions to quadratic equations of the form ax2 + bx + c = 0.

There are two unique real solutions if the discriminant is positive. There is only one viable option if the discriminant is zero. There are no practical solutions, however, if the discriminant is negative.

The quadratic equation in this instance has two complex solutions that are conjugates of one another. Because the quadratic equation must have either two real solutions or two complex solutions, there can never be just one hypothetical solution.

Learn more about imaginary solution at: https://brainly.com/question/5564133

#SPJ1

An equilateral triangle has a perimeter of 36 inches. What is the height of the triangle? Express your answer as a simplified radical.

Answers

Answer: the height of the equilateral triangle is 6√3 inches.

Step-by-step explanation:

To find the height of an equilateral triangle, we can use the formula:

height = (√3/2) * side

In this case, we are given the perimeter of the triangle, which is 36 inches.

Since an equilateral triangle has three equal sides, each side would be 36 inches divided by 3, which is 12 inches.

Now we can substitute the side length into the formula:

height = (√3/2) * 12

Simplifying:

height = (√3/2) * 12

height = (√3 * 12)/2

height = (12√3)/2

height = 6√3

Therefore, the height of the equilateral triangle is 6√3 inches.

Answer:

RG

Step-by-step explanation:

Describe the location of point (−7, 6, −4) in three-dimensional coordinate space.

Answers

The description of the location of the point, (−7, 6, −4) in three-dimensional coordinate space is this: A.  From the origin, move 7 units back, 6 units right, and 4 units down.

What is a three-dimensional coordinate space?

The meaning of a three-dimensional coordinate space is a requirement for three units to come together to form a point. In the location of the point above, we are given three units namely, -7, 6, and -4.

The indication of signs in front of them are as follows; -7, means moving 7 units back, 6 means moving 6 units right, ad -4 means moving 4 units down.

Learn more about the three-dimensional coordinate space here:

https://brainly.com/question/12222096

#SPJ1

100 Points! Geometry question. Photo attached. Determine whether the quadrilateral is a parallelogram. Justify your answer using a theorem. Please show as much work as possible. Thank you!

Answers

The prove of the statement is described below.

First of all ,

Labeling the given figure

And draw  a diagonal,

In the quadrilateral PQRS,

The side PQ is equal to the side RS.

Therefore,

PQ = RS

And also, the side PQ is parallel to the side RS.

Then,

PQ || RS.

Now, draw the diagonal PR.

We know that a parallelogram's diagonal divides the parallelogram into two congruent triangles.

By the rule of  Side-Angle-Side,

we can show that ∆ PQR ≅ ∆ RSP.

Therefore,

The side QR is parallel to PS

Then,

QR || PS.

Hence,

PQRS is a parallelogram.

To learn more about quadrilaterals visit:

brainly.com/question/11037270

#SPJ1

An auto body shop repaired 22 cars and trucks. There were 8 fewer cars than trucks. How many trucks were repaired. URGENT PLEASE HELP

Answers

If an auto body shop repaired 22 cars and trucks and there were 8 fewer cars than trucks, 15 trucks were repaired.

Let's assume the number of trucks repaired is "x". We know that the total number of cars and trucks repaired is 22. Since there were 8 fewer cars than trucks, the number of cars repaired must be x-8. Therefore, we can set up the following equation:

x + (x-8) = 22

Simplifying, we get:

2x - 8 = 22

Adding 8 to both sides:

2x = 30

Dividing by 2:

x = 15

We can check this by plugging x back into the equation and verifying that the number of cars repaired is 7, which is 8 fewer than 15.

To learn more about equation click on,

https://brainly.com/question/3298560

#SPJ1

Ms. Edwards is redecorating her office. She has a choice of 8 colors of paint, 5 kinds of curtains, and 6 colors of carpet. How many different ways are there to redecorate?

240 ways
297 ways
357 ways
19 ways

Answers

Answer:

To determine the total number of different ways Ms. Edwards can redecorate her office, we need to multiply the number of choices for each item:

Number of paint color choices = 8

Number of curtain choices = 5

Number of carpet color choices = 6

To calculate the total number of ways, we multiply these choices together:

Total number of ways = Number of paint color choices × Number of curtain choices × Number of carpet color choices

= 8 × 5 × 6

= 240

Therefore, there are 240 different ways for Ms. Edwards to redecorate her office. So, the answer is 240 ways.

Other Questions
2 peter uses the flood narrative out of the book of genesis to support what argument made by the author?A. God destroyed the world once in response to evil and will do so againB. Even in the midst of terrible storms, God keeps the faithful afloat C. God allows natural disasters to occur even if people are harmedD. The olive branch of peace always follows terrible destruction it is observed that 50% of e-mail is spam. a software program that filters spam before reaching an in-box has an accuracy of 99% of detecting spam but a 5% chance of tagging non-spam as a spam e-mail. what is the probability that 1 email tagged as spam is not spam? 6-5. (from the previous table) what is the largest amount of slack that any activity in the project has? group of answer choices a. 1 week b. 2 weeks c. 3 weeks d. 4 or more weeks ________ featured twelve-bar blues progressions and ""boogie"" rhythms while incorporating musical elements common to country music. the fan blades on a jet engine have a moment of inertia 30.0 kg-m 2 . in 10 s, they rotate counterclockwise from rest up to a rotation rate of 20 rev/s. a). What torque must be applied to the blades to achieve this angular acceleration?b). What is the torque required to bring the fan blades rotating at 20 rev/s to a rest in 20 s? the chemical analysis of a macromolecule has been provided. what is this macromolecule? It is known that amounts of money spent on textbooks in a year by students follow a normal distribution with mean $400 and standard deviation $50. Find the shortest range of dollar spending on textbooks in a year that includes 60% of all students. Choose the example that is punctuated correctly.I am writing a report with a coworker. Because we are going to use the criteria organization method we have to examine each plan by the same standard.I am writing a report with a coworker. Because we are going to use the criteria organization method, we have to examine each plan by the same standard.I am writing a report with a coworker because we are going to use the criteria organization method, we have to examine each plan by the same standard. Fantasy essay 200 words Calculate the ph of a solution containing 20 ml of 0.001 m hcl and 0.5 ml of 0.04 m sodium acetate. give the answer in two sig figs. 20 pts) determine the moment of f = {300i 150j 300k} n about the x axis using the dot and cross products. A force F of 10 N is applied in the direction indicated, per meter depth (into page). The 300 mm long triangular beam is Aluminum, 1100 series, and extends 2 meters into the page. What is the moment about point A, per meter of depth? The system is on Earth, at sea level, gravity acts in the direction of F.Note: The centroid of a triangle is located at h/3.A) 16 Nm/mB) 19 Nm/mC) 24 Nm/mD) 27 Nm/m What is the measurement of N? it is common for a developer to hold back funds before making final payment to ensure that subcontractors perform all work completely. group startstrue or false a 75 year old patient is complaining of shortness of breath. vital signs are bp 160/88, p 130, and r 22 with crackles in the bases of the lungs. you should A client who is anticipating total hip replacement is considering autologous transfusion. When teaching this client about autologous transfusion, it is important to emphasize that?-It reduces the risk of mismatched blood-A hemoglobin level above 9.5 mg/dL is required-there is no need to test the blood for infectious diseases-Donations may be made every other day PWEEZ helpBased on the results of the second simulation, if 224 groups are formed, about how many of them would you expect to contain all girls? Round your answer to the nearest number of groups true/false. the number of levels of observed x-values must be equal to the order of the polynomial in x that you want to fit. If the Watson strand for a double stranded DNA is 5 ATGGTCATGGGTTCCAATGCA 3, what is the sequence of the Crick strand? Find the center of mass of a thin triangular plate bounded by the coordinate axes and the line x + y = 9 if (x,y) = x + y. A)x=2,y=2B) x=54,y=54C)x=98,y=98D)x=1,y=1