Answer:
D
Explanation:
the other answers are incorrect
Which explanation describes why males are more likely to exhibit sex-linked disorders than females?
A male with a mutation in a gene on the X chromosome is typically affected with the condition. Because females have two copies of the X chromosome and males have only one X chromosome, X-linked recessive diseases are more common among males than females.
6.______________________ is a special type of muscle found only in your heart and causes your heart to beat.
smooth muscle
skeletal muscle
cardiac muscle
Explanation:
the answer is C cardiac muscle I'm pretty sure this is the correct answer
An area of land that is not used by humans for agriculture, industry, or habitation is called __________.
A)
wilderness
B)
rangeland
C)
public land
D)
sustainable forest
E)
private land
Explanation:
range land....,....,,...................
Which option identifies the most likely contributor to a microclimate that forms in a northern-facing valley?
exposure
shelter
precipitation
topography
Answer:
Topography
Explanation:
I just took the quiz.
Answer: pretty sure it’s topography
Explanation: edge 2021
Which types of plant cells must receive glucose from other plant cells?
Answer:
While plant cells have chloroplasts to photosynthesize, they also require ATP for cellular functions, and do use oxygen to break down some of the sugar they produce in order to generate that ATP. They need mitochondria for this.
In particular, at night when there is no light, plants undergo cellular respiration since there is no sunlight to photosynthesize.
They do, however, produce far more sugar and oxygen through photosynthesis than they use up in respiration.
The type of plant cells that receives glucose from other plant cells are NON-PHOTOSYNTHETIC plant cells.
Photosynthesis is a group of metabolic reactions by which plant cells generate simple carbohydrates (i.e., glucose) and oxygen by using the energy from the sun, carbon dioxide and water.In consequence, non-photosynthetic cells cannot produce glucose and thus need to receive this nutrient from photosynthetic cells.An example of non-photosynthetic cells is the root cells found underground.In conclusion, the type of plant cells that receives glucose from other plant cells are NON-PHOTOSYNTHETIC plant cells.
Learn more in:
https://brainly.com/question/1388366
What is lapse rate with respect to the atmosphere?
Answer:
The term is almost always used with respect to temperature but is occasionally used for other variables.
Explanation:
What percent of the energy from an organism is passed to the organism that eats it?
10%
25%
100%
1%
10%
Explanation:
im sorry if im wrong but from what i learned thats the percentage
Answer:
10%
Explanation:
2. What can you infer from the fact that ants make up
20 percent of the mass of all land animals combined?
a. Ants are very heavy
b. Ants live for a long time
c. Ants thrive in locations all over the world
d. Ants breed faster than any other organism on earth
Ant breed faster than any other organism on earth, 20% of earth mass have land animals. Many ants are on the earth. Thus, option D is correct.
What are the major features of ants ?Ants belongs to Formicide family which is related to so called eusocial insects like bees and termites. It is appeared in the Cretaceous period that is more than 90 million years ago.
The diversity of ants is every where except Antarctica.
The body has three parts such as a head, a meso-some and metasoma or gaster.
Ants are mostly omnivorous but can be scavengers , predators or herbivores based on ecological context.
The reproduction in which young, queens fly during mating time, fertilize with male, this flight is called as nuptial flight.
Then queen lay eggs, then larvae emerge to become pupae, then adults such as workers, soldiers, males or other queens are produced.
Thus, option D is correct.
Learn more about ants, here:
https://brainly.com/question/932986
#SPJ2
Can someone explain?
Answer:
A greenhouse keeper...
What does an ecopsychologist study? a. the mental health of environmental scientists b. the relationship between animals' interactions and their mental health c. the relationship between animals' behavior and the environment d. the relationship between a person's mental health and the environment
Answer:
The correct answer is d. the relationship between a person's mental health and the environment.
Explanation:
Ecopsychology is aimed at identifying the way in which the emotional aspects of human beings are influenced by the environment, that is, ecopsychology collects multiple experiences that connect human development with environmental awareness. Ecopsychologists are oriented to the search for the well-being of the human being through its connection with natural processes through the understanding of the complex interrelationships between people and the environment.
Answer:
The correct answer is d. the relationship between a person's mental health and the environment.
Explanation:
Ecopsychology is aimed at identifying the way in which the emotional aspects of human beings are influenced by the environment, that is, ecopsychology collects multiple experiences that connect human development with environmental awareness. Ecopsychologists are oriented to the search for the well-being of the human being through its connection with natural processes through the understanding of the complex interrelationships between people and the environment.
HELP NEED THIS BY TODAY!
What did Mendel study that lead him to his discovery
Answer:
A monk, Mendel discovered the basic principles of heredity through experiments in his monastery's garden. His experiments showed that the inheritance of certain traits in pea plants follows particular patterns, subsequently becoming the foundation of modern genetics and leading to the study of heredity.
Explanation:
Answer:
Mendel studied the genetics of pea plants.
Explanation:
Mendel looked at the pea plants in his monastery garden to determine genetics. He found that some plants had white flowers, while some did not, and he used that discovery to determine the genetics of the plants.
NEED ANSWER ASAP
Students in a Biology class were formulating an argument about a cell they viewed under the microscope. Half
of the class argued it was a plant cell and the other half argued in favor of an animal cell. Below is the image the
students saw under the microscope. Which argument is supported by the image?
A. The students who said the plant cell are correct because there are chloroplasts
B. The students who said a plant cell are correct because there are mitochondria present.
C. The students who said animal cell are correct because there are chloroplasts present.
D. The students who said an animal cell are correct because there are mitochondria present.
Answer:
the answer would be A
Explanation:
Animal cells are oval and egg shaped so we can cancel out c and d
A is the correct answer because we can see green dots within the structure. Chloroplasts contain a green pigment called chlorophyll. This green pigment makes the chloroplast and the structure green (as we can see in the picture). Photosynthesis occurs in the chloroplasts, and it is where the plant gets its glucose from
Hope this helps!
what are the advantages of anaerobic respiration and aerobic respiration?
why are viruses not regarded as true living cells?
Explanation:
Most biologists say no. Viruses are not made out of cells, they can't keep themselves in a stable state, they don't grow, and they can't make their own energy. Even though they definitely replicate and adapt to their environment, viruses are more like androids than real living organisms.
Viruses are not comprised of cells, they cannot maintain a stable internal environment, they cannot reproduce, and they cannot produce their own energy.
What is environment?Environment is defined as a compilation of all the factors living and nonliving and the outcomes they have on human life. Due to their ties to the forest, its plants, wildlife, water, and air. The air is filtered and hazardous gases are absorbed by the forest and trees. Plants filter water, lessen the likelihood of flooding, preserve the natural equilibrium, and do many other things.
Viruses are more like robots than actual living things, even though they do replicate and adapt to their surroundings. The viruses are thought to be dead in their natural habitat since they lack any cell-like properties. However, inside the host cell, the viruses employ the host's technological infrastructure to carry out all necessary tasks including reproduction.
Thus, viruses are not comprised of cells, they cannot maintain a stable internal environment, they cannot reproduce, and they cannot produce their own energy.
To learn more about environment, refer to the link below:
https://brainly.com/question/13107711
#SPJ6
How do you think about the invention of the microscope? Influenced the cell theory?
And what are the components of the cell theory?
Answer:
See the answer below
Explanation:
The invention of the microscope paved way for the development of the cell theory because, without it, the cell and all the organelles of the cell would not have been discovered and or studied in great detail. It was through the use of a microscope that Robert Hooke was able to observe and name the cell and it was through the same microscope that the fine details of the cell were able to be studied by other scientists, culminating in the formulation of the cell theory.
The cell theory states that all living organisms are made up of cells, the cell is the basic unit of all life, and cells can only arise from already existing cells (via cell division). The components of the cell theory, therefore, are:
Living organisms are made up of cells.The cell represents the basic unit of life.Cells can only arise from preexsiting cells.Water, ice, wind, sand, and chemicals are constantly crumbling mountains, flattening hills, widening valleys, and deepening canyons. __________________ never stops
Answer:
erosion
Explanation:
Why would the atomic number be better to identify an element than the atomic mass?
Answer:
because the atomic number tells you how many protons and neutrons there are
Explanation:
Pls, I need help with this! Biology Thank you :)
Answer:
If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG
If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG
Explanation:
Biology Grade 8
Match correct terms/meaning given in column 'B' with their correct levels
given in column 'A' with Column 'B'
Column A
a.Cell
b.Plant
c.Tissue
d.nose
e.organelle
column B
a.Group of similar cells
b.Heart
c.Ova
d.Organ
e.Group of different cells
f.Nucleus
g.organism
Answer:
cell=ova
plant=organism
tissue=group of similar cells
nose=organ
organelle=nucleus
The roots allow for plants to bring in carbon dioxide and release oxygen.
True
False
Answer:
true 100 percent
Explanation:
Project: Earths layers
Answer:
here hope helps
Explanation:
please asap help i am not even sure if my ans is correct but help me out
Answer and Explanation:
Step 1:
Sound waves reach the bat's ears.
Step 2:
Sensory neurons send electrical signals to the brain.
Step 3:
Brain learns information about the environment.
Step 4:
Brain sends electrical signals to the muscles.
Step 5:
Bat flies away from the owl.
This is the correct way^
#teamtrees WAP (Water And Plant)
My teacher is bugging me to answer this question help
Please help me out!
Diploid is to Body Cell as Haploid is to?
-Sex Cells
-Zygote
-Chromosome
-Sex Chromosome
The sun converts nuclear energy into what type of energy?
Answer:
i would say chemical but if im wrong im super sorry!!
Explanation:
What cell structures are made in G1?
Answer:
Organelles
Explanation:
During G1, there is a great amount of protein _____________________ occurring.
Answer:
G1 is an intermediate phase occupying the time between the end of cell division in mitosis and the beginning of DNA replication during S phase. During this time, the cell grows in preparation for DNA replication, and certain intracellular components, such as the centrosomes undergo replication.
Explanation:
During G1, there is a great amount of protein synthesis occuring.
as a result of fertilization_____is formed
Answer:
zygote
Explanation:
Fertilization is the process in which haploid gametes fuse to form a diploid cell called a zygote. To ensure that each zygote has the correct number of chromosomes, only one sperm can fuse with one egg.
I hit a substance with a hammer and it shatters.It is a
Answer:
non metal ,so it is brittle in nature
DNA fingerprint can be obtained from… (check all that apply)
Answers:
the pattern on a finger
hair with follicle attached
skin
blood
hair with no follicle attached
Answer:
Did u really delete mine so u can get credit wow you're crazy
Explanation: